View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_low_108 (Length: 221)
Name: NF2729_low_108
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_low_108 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 221
Target Start/End: Complemental strand, 21484920 - 21484714
Alignment:
| Q |
16 |
attacaccagaagaatacttgaacaaaagg-taatcaaacttcaaagtttttcaagtttgagagaagtttttgaaagataaagttagatcttgttatgga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21484920 |
attacaccagaagaatacttgaacaaaagggtaatcaaacttcaaagtttttcaagtttgagagaagttttttaaagataaagttagatcttgttatgga |
21484821 |
T |
|
| Q |
115 |
gtgtggtttagatctgcatgcaaagttggtgaatgaaacagaacaagttggttttggaaatttagcagaagaaaattggcttaataatactacaaatgat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484820 |
gtgtggtttagatctgcatgcaaagttggtgaatgaaacagaacaagttggttttggaaatttagcagaagaaaattggcttaataatactacaaatgat |
21484721 |
T |
|
| Q |
215 |
caagatg |
221 |
Q |
| |
|
||||||| |
|
|
| T |
21484720 |
caagatg |
21484714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University