View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_low_110 (Length: 217)
Name: NF2729_low_110
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_low_110 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 2525635 - 2525837
Alignment:
| Q |
1 |
taatatcatatatgaaagcaaaatagaaggggcactttcactgcacacataaaaagtatcgtcaactaaatatattcaannnnnnnnnnnnnnnnnnnnc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
2525635 |
taatatcatatatgaaagcaaaatagaaggggcactttcactgcacacataaaaagtatcgtcaattaaatatattcaattttttttgataatttttttc |
2525734 |
T |
 |
| Q |
101 |
-ttatatttaagaccgaagtatacaagtattcaaagatttttctcataagctactttcatgagaagagtttgaccaccaatttcttaacacacacatact |
199 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||| ||||||||||||| ||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
2525735 |
cttatatttaagaccgaagtatacaaatattcaaagatttttcttataaactactttcatgaggagagtttgagcaccaatttcttaacacacgcatact |
2525834 |
T |
 |
| Q |
200 |
tgt |
202 |
Q |
| |
|
||| |
|
|
| T |
2525835 |
tgt |
2525837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University