View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_low_111 (Length: 213)
Name: NF2729_low_111
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_low_111 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 193
Target Start/End: Original strand, 4474334 - 4474508
Alignment:
| Q |
19 |
gaccgagaaacaatctccacgtcttttatccttagccccgcgaatgtcacaaagattaatgttttgattgccaaggtttccgagacgaataggtatgtaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
4474334 |
gaccgagaaacaatctccacgtcttttatccttagccccgcgaatgtcacaaagattaatgttttgattgccaaggtttccgagacgaataggtacgtga |
4474433 |
T |
|
| Q |
119 |
aatatacgaaagggactaaggataagagaattaaagctcttagaatgcttccagcttcgagtgcgacgagcatgt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4474434 |
aatatacgaaagggactaaggataagagaattaaagctcttagaatgcttccagcttcgagtgcgacgagcatgt |
4474508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University