View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_low_112 (Length: 212)
Name: NF2729_low_112
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_low_112 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 28806195 - 28806085
Alignment:
| Q |
1 |
actattgagtctttgaatgaaagagaaagaaaataaaaggaaaagggtaaagcttgaatgatatgaagctttcaacatcagggttgggtcagcagggaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28806195 |
actattgagtctttgaatgaaagagaaagaaaataaaaggaaaagggtaaagcttgaatgatatgaagctttcaacatcagggttgggtcagcagggaca |
28806096 |
T |
|
| Q |
101 |
tgaaggtatcc |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
28806095 |
tgaaggtatcc |
28806085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 169 - 212
Target Start/End: Complemental strand, 28806027 - 28805982
Alignment:
| Q |
169 |
gtcttacatatatataaatatgtt--gtgtctctatcatagtactc |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28806027 |
gtcttacatatatataaatatgttgtgtgtctctatcatagtactc |
28805982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 110
Target Start/End: Complemental strand, 32499239 - 32499170
Alignment:
| Q |
41 |
aaaagggtaaagcttgaatgatatgaagctttcaacatcagggttgggtcagcagggacatgaaggtatc |
110 |
Q |
| |
|
|||| |||| |||||| || ||||||||||||||||||||| || |||||||||| |||||||||||| |
|
|
| T |
32499239 |
aaaaaggtatagcttgtgtgttatgaagctttcaacatcaggaatgagtcagcagggtcatgaaggtatc |
32499170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University