View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2729_low_28 (Length: 452)

Name: NF2729_low_28
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2729_low_28
NF2729_low_28
[»] chr1 (1 HSPs)
chr1 (386-444)||(4715393-4715451)
[»] chr5 (1 HSPs)
chr5 (297-334)||(41043216-41043253)


Alignment Details
Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 386 - 444
Target Start/End: Complemental strand, 4715451 - 4715393
Alignment:
386 aaattttattgccaccacaatctatggctccaccaataatataaaagctactgatgatg 444  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
4715451 aaattttattgccaccacaatctatggctccaccaataatataaaagctactcatgatg 4715393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 297 - 334
Target Start/End: Original strand, 41043216 - 41043253
Alignment:
297 tgatcattttgactctttatagagtcaatggcagcttg 334  Q
    |||| |||||||||||||||||| ||||||||||||||    
41043216 tgattattttgactctttatagaatcaatggcagcttg 41043253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University