View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2729_low_61 (Length: 313)

Name: NF2729_low_61
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2729_low_61
NF2729_low_61
[»] chr3 (2 HSPs)
chr3 (227-305)||(50247709-50247787)
chr3 (241-277)||(50247637-50247673)
[»] chr8 (2 HSPs)
chr8 (89-155)||(21546021-21546088)
chr8 (204-276)||(7498691-7498763)
[»] chr4 (1 HSPs)
chr4 (102-152)||(46885285-46885336)


Alignment Details
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 227 - 305
Target Start/End: Original strand, 50247709 - 50247787
Alignment:
227 gtgtgaaggatgttttatatagtcaatagacattatactttattgacttgaggccgacaaacattacctatgctactcc 305  Q
    ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| ||||    
50247709 gtgtgtaggatgttttatatagtcactagacattatactttattgacttgaggccgacaaacattacttatgcttctcc 50247787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 241 - 277
Target Start/End: Complemental strand, 50247673 - 50247637
Alignment:
241 ttatatagtcaatagacattatactttattgacttga 277  Q
    ||||||||||| |||||||||||||||||||||||||    
50247673 ttatatagtcactagacattatactttattgacttga 50247637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 89 - 155
Target Start/End: Complemental strand, 21546088 - 21546021
Alignment:
89 ggagaagcagccacaaataagtatgggtgttattttt-ggttgattagaacatgattaaatgaatatt 155  Q
    ||||||| ||||||||||| ||||| ||  ||||||| ||||||||| ||||||||||||||||||||    
21546088 ggagaagtagccacaaatatgtatgagtactattttttggttgattataacatgattaaatgaatatt 21546021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 204 - 276
Target Start/End: Original strand, 7498691 - 7498763
Alignment:
204 gaggcttattttaattttgcttcgtgtgaaggatgttttatatagtcaatagacattatactttattgacttg 276  Q
    |||||||||||  ||||| ||  ||||| ||||||||||||| || |||||||| |||| |||||||||||||    
7498691 gaggcttatttagattttactatgtgtgtaggatgttttataaagccaatagaccttatgctttattgacttg 7498763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 102 - 152
Target Start/End: Original strand, 46885285 - 46885336
Alignment:
102 caaataagtatgggtgttatttt-tggttgattagaacatgattaaatgaat 152  Q
    ||||||||||||||| ||||||| |||||||||| |||||||||||||||||    
46885285 caaataagtatgggtattattttttggttgattataacatgattaaatgaat 46885336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University