View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_low_63 (Length: 309)
Name: NF2729_low_63
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 19 - 294
Target Start/End: Complemental strand, 31656472 - 31656196
Alignment:
| Q |
19 |
agttatcactgctaacctcacctatggaagtctcattggtgttgaaggtttacaacaagaagagctttttgtttggttacctgttaaagatatcattgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31656472 |
agttatcactgctaacctcacctatggaagtctcattggtgttgaaggtttacaacaagaagagctttttgtttggttacctgttaaagatatcattgtt |
31656373 |
T |
 |
| Q |
119 |
gatgatccttcttctggtttgattctctttgacattggtcttgcttataaacaactctctttctctctctttgaagttcctcctcattgtaaacctcaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31656372 |
gatgatccttcttctggtttgattctctttgacattggtcttgcttataaacaactctctttctctctctttgaagttcctcctcattgtaaacctcaag |
31656273 |
T |
 |
| Q |
219 |
gtaaattcatagannnnnnnnnnctttatttgattaacaagatga-ttttttgatagatctgctactaccccctttg |
294 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
31656272 |
gtaaattcatagaatttttttttctttatttgattaacaagatgatttttttgatagatctgctactaccccttttg |
31656196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 77 - 164
Target Start/End: Original strand, 36484658 - 36484745
Alignment:
| Q |
77 |
gaagagctttttgtttggttacctgttaaagatatcattgttgatgatccttcttctggtttgattctctttgacattggtcttgctt |
164 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||| |||||| ||||| ||||||||| | |||||| |||| |||||| |||||| |
|
|
| T |
36484658 |
gaagagcttttcttgtggttacctgttaaagatatctttgttgtggatccatcttctggtgtaattctcattgatattggttttgctt |
36484745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 74 - 194
Target Start/End: Complemental strand, 2605326 - 2605206
Alignment:
| Q |
74 |
caagaagagctttttgtttggttacctgttaaagatatcattgttgatgatccttcttctggtttgattctctttgacattggtcttgcttataaacaac |
173 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||| ||||||||||| || ||| | ||||| |||| |||||||||||||||||||| | |
|
|
| T |
2605326 |
caagaagagctttttctttggttacctgtcaaagatatcattgtggatgatccttcatcaggtctcattcttattgatattggtcttgcttataaacagc |
2605227 |
T |
 |
| Q |
174 |
tctctttctctctctttgaag |
194 |
Q |
| |
|
||||| | ||||||||||||| |
|
|
| T |
2605226 |
tctctctttctctctttgaag |
2605206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 131 - 207
Target Start/End: Complemental strand, 30527127 - 30527051
Alignment:
| Q |
131 |
tctggtttgattctctttgacattggtcttgcttataaacaactctctttctctctctttgaagttcctcctcattg |
207 |
Q |
| |
|
|||||| | |||| |||||| ||||| ||||| |||||||| ||||||| ||||||||||||| ||| ||| |||| |
|
|
| T |
30527127 |
tctggtcttattcactttgatgttggtgttgctgataaacaattctctttgtctctctttgaagatccccctgattg |
30527051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University