View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_low_93 (Length: 247)
Name: NF2729_low_93
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_low_93 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 44322009 - 44321776
Alignment:
| Q |
1 |
cttggctcgatagattttggattgaaggtaaaagctcttggcgtttttctcaaacatagtttcaaatttctgcacaacataaatgtatgttttgagcaca |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44322009 |
cttggctcgatggattttggattgaaggtaaaagctcttggtgtttttctcaaacatagtttcaaatttctgcacaacataaatgtatgtttttagcaca |
44321910 |
T |
|
| Q |
101 |
tttacatgtcacaataaacagataagaagcgagacacaaattgataaactaacctttacaatatcttcccaggatgttttctctgtcacaccaagaatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44321909 |
tttacatgtcacaataaacagataagaagcgagacacaaattgataaactaacctttacaatatcttcccaggatgttttctctgtcacaccaagaatca |
44321810 |
T |
|
| Q |
201 |
gttgagcctcttcccctgtcatcattttgcttcc |
234 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |
|
|
| T |
44321809 |
gtcgagcctcttcccctgtcatcattttgcttcc |
44321776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 154 - 234
Target Start/End: Complemental strand, 48008881 - 48008801
Alignment:
| Q |
154 |
ctttacaatatcttcccaggatgttttctctgtcacaccaagaatcagttgagcctcttcccctgtcatcattttgcttcc |
234 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48008881 |
ctttacaatatcttcccagaatgttttctctgtcacgccaagaatcagttgagcctcttccactgtcatcattttgcttcc |
48008801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University