View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2729_low_98 (Length: 238)
Name: NF2729_low_98
Description: NF2729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2729_low_98 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 46580059 - 46579834
Alignment:
| Q |
1 |
tgactatcacttgtattatttgaatatcaaaatgcaaatattgtatatgatgtccaataattatttttctataactatgtatgattatattcaaatgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46580059 |
tgactatcacttgtattatttgaatatcaaaatgcaaatattgtatatgatgtccaataattatttttctataactatgtatgattatattcaaatgaaa |
46579960 |
T |
|
| Q |
101 |
ctgggaattttactttctattcatt---ttttctctctcttgtatcactttacacatttttaacatacccccagcaatttttccgatattatattccatc |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46579959 |
ctgggaattttactttctattcatttttttttctctctcttgtatcactttacacatttttaacatacccccagcaatttttccgatattatattccatc |
46579860 |
T |
|
| Q |
198 |
ctatgtagtgtgagacaagtattatg |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46579859 |
ctatgtagtgtgagacaagtattatg |
46579834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University