View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2730_high_11 (Length: 333)
Name: NF2730_high_11
Description: NF2730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2730_high_11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 24 - 333
Target Start/End: Complemental strand, 48482729 - 48482420
Alignment:
| Q |
24 |
atcaatatatagatttttatggaagtaagcatttagttacatggctattacttccgctgctgggaaaatatgttgatattgtttaaatgtacagttgcgt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48482729 |
atcaatatatagatttttatggaagtaagcatttagttacatggctattacttccgctgctgggaaaatatgttgatattgtttaaatgtacagttgcgt |
48482630 |
T |
 |
| Q |
124 |
tctacagtgaagaaggggactcaaataacacagacgctaatatattgtgcagttcacaggtttgagctctggtctttcaattatgctaatcttattttcc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48482629 |
tctacagtgaagaaggggactcaaataacacagacgctaatatattgcgcagttcacaggtttgagctctggtcttccaattatgctaatcttattttcc |
48482530 |
T |
 |
| Q |
224 |
atgtgttcttttgaaaaactgtttttacattttaatttcattttagggtcccaaatccagattcagtagtggttgtgcatacccctctgggggtattctc |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48482529 |
atgtgttcttttgaaaaactgtttttacattttaatttcattttagggtcccaaatccagattcagtagtggttgtgcatacccctctgggggtattctc |
48482430 |
T |
 |
| Q |
324 |
tccaagaact |
333 |
Q |
| |
|
|||||||||| |
|
|
| T |
48482429 |
tccaagaact |
48482420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University