View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2730_high_13 (Length: 330)
Name: NF2730_high_13
Description: NF2730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2730_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 42824934 - 42824615
Alignment:
| Q |
1 |
gaacctctaaactgttcaatcttctccctcaactcaacaagcggcgcccgcatccgcaccaccgccgcatccacatcaacaagcttcgtactcaaattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42824934 |
gaacctctaaactgttcaatcttctccctcaactcaacaagcggcgcccgcatccgcaccaccgccgcatccacatcaacaagcttcgtactcaaattaa |
42824835 |
T |
 |
| Q |
101 |
cgaaatcagcataatcgcgattgattagatcaatgagctcgtgatttagcgacgagagatagttgctgagttccgatcggagagtgtcgaatgggacgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42824834 |
cgaaatcagcataatcgcgattgattagatcaatgagctcgtgatttagcgacgagagatagttgttgagttccgatcggagagtgtcgaatgggacgaa |
42824735 |
T |
 |
| Q |
201 |
ggttcggagttcggaaatgtaggattcggaatcgaagtcaggggagaggaaggaggtaggtttgaaccagagaggatgggagtcgagtgggtcggagaag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42824734 |
ggttcggagttcggaaatgtaggattcggaatcgaagtcaggggagaggaaggaggtaggtttgaaccagagaggatgggagtcgagtgggtcggagaag |
42824635 |
T |
 |
| Q |
301 |
aggtttgtggtggatctgtg |
320 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42824634 |
aggtttgtggtggatctgtg |
42824615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 96 - 251
Target Start/End: Original strand, 48411586 - 48411741
Alignment:
| Q |
96 |
attaacgaaatcagcataatcgcgattgattagatcaatgagctcgtgatttagcgacgagagatagttgctgagttccgatcggagagtgtcgaatggg |
195 |
Q |
| |
|
|||| ||||||||| |||||||||||||| |||| |||||| | ||||||||| || || || |||||| |||||| || |||||||||| ||| || |
|
|
| T |
48411586 |
attagcgaaatcagagtaatcgcgattgataagatgaatgagttggtgatttagggatgaaaggtagttgttgagttgtgaacggagagtgtggaaggga |
48411685 |
T |
 |
| Q |
196 |
acgaaggttcggagttcggaaatgtaggattcggaatcgaagtcaggggagaggaa |
251 |
Q |
| |
|
||||||||| | |||| || ||||| |||||||||||||||| |||||||||||| |
|
|
| T |
48411686 |
acgaaggttggaagttgagagatgtatgattcggaatcgaagttaggggagaggaa |
48411741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University