View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2732_low_14 (Length: 250)
Name: NF2732_low_14
Description: NF2732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2732_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 168 - 246
Target Start/End: Complemental strand, 27039062 - 27038984
Alignment:
| Q |
168 |
aaggtaatgtttctataattcatattttgaggcaaaatactcgactacaaccaggttgaagatatctgtctcacacata |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
27039062 |
aaggtaatgtttctataattcatattttgaggcaaaatactcgactacaaccacgttgaagatatctttctcacacata |
27038984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University