View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2733_high_10 (Length: 394)
Name: NF2733_high_10
Description: NF2733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2733_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 11 - 373
Target Start/End: Complemental strand, 7247269 - 7246907
Alignment:
| Q |
11 |
caaaggcaggtgcagagnnnnnnncagaagcatcacaggttcagtcattataagttcagactcactatctcacccatccaccacatagcaaaaattagtg |
110 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7247269 |
caaaggcaggtgcagagaaaaaaacagaagcatcacaggttcagtcattataagttcagactcactatctcacccatccaccacatagcaaaaattagtg |
7247170 |
T |
 |
| Q |
111 |
aagaggtggcagaacacaattttcatattcattaactattatccatccatgcacagtacaataatctccaacccctcttaaccctcttaaataaaagcat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7247169 |
aagaggtggcagaacacaattttcatattcattaactattatccatccatgcacagtacaataatctccaacccctcttaaccctcttaaataaaagcat |
7247070 |
T |
 |
| Q |
211 |
cttcaagaaaatccttatttttgtttctcaaaaaatgatgagtgcaagttcaagaaataggtcacttttcacaccaaatcaatggcaagaacttgaacaa |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7247069 |
cttcaagaaaatccttatttttgtttctcaaaaaatgatgagtgcaagttcaagaaataggtcacttttcacaccaaatcaatggcaagaacttgaacaa |
7246970 |
T |
 |
| Q |
311 |
caagccctagtttttaaatacatggttactggaacacctattccaccagatctcatatactct |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7246969 |
caagccctagtttttaaatacatggttactggaacacctattccaccagatctcatatactct |
7246907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University