View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2733_high_17 (Length: 250)
Name: NF2733_high_17
Description: NF2733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2733_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 39733697 - 39733934
Alignment:
| Q |
1 |
catgttgaataaaagaagggtctaactaccctgtggaaaagtatcctctacctttaccgcaggaaactcaccatgacttttgggtagtttatgagagaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39733697 |
catgttgaataaaagaagggtctaactacccagtggaaaagtatcctctacctttaccgcgggaaactcaccatgacttttgggtagtttatgagagaaa |
39733796 |
T |
|
| Q |
101 |
aatgtgggagagaaagaagagataacatgagagagcagccactttggtgtagtcaccaccatgacttcaattctcttttttgaactctttccaagccctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39733797 |
aatgtgggagagaaagaagagataacatgagagagcagccactttggtgtagtcaccaccatgacttcaattctcttttttgaactctttccaagccccg |
39733896 |
T |
|
| Q |
201 |
gaaggcaccccttnnnnnnnngtgaaaatgcacatatt |
238 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |
|
|
| T |
39733897 |
gaaggcaccccttaaaaaaaagtgaaaatgcacatatt |
39733934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University