View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2733_high_19 (Length: 246)

Name: NF2733_high_19
Description: NF2733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2733_high_19
NF2733_high_19
[»] chr5 (2 HSPs)
chr5 (60-229)||(29237201-29237370)
chr5 (99-229)||(29233451-29233581)
[»] chr7 (1 HSPs)
chr7 (6-61)||(42028122-42028177)
[»] chr1 (1 HSPs)
chr1 (45-148)||(26629700-26629803)


Alignment Details
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 60 - 229
Target Start/End: Complemental strand, 29237370 - 29237201
Alignment:
60 gcatgctacaaagctttaaacgatcatcatgttctgctggaaggcacccttttgaagcctaacatggtcacccctggttcagattctccaaaggtttccc 159  Q
    ||||||||||| || || || || || ||||| || || |||||||| || ||||||||||||||||| |||||||| || ||| | ||||||||| | |    
29237370 gcatgctacaaggccttgaatgaccaccatgtcctccttgaaggcactctcttgaagcctaacatggttacccctggatctgatgcaccaaaggttgcac 29237271  T
160 ccgaagttatagctgagtataccgttaaagctttgcagcgaaccgttccggctgccgttcctgctgttgt 229  Q
    |||| ||| | |||||| | ||||||| |||||||||| ||||||| || ||||| || || ||||||||    
29237270 ccgaggttgttgctgagcacaccgttagagctttgcagagaaccgtacctgctgcagtcccagctgttgt 29237201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 99 - 229
Target Start/End: Complemental strand, 29233581 - 29233451
Alignment:
99 gaaggcacccttttgaagcctaacatggtcacccctggttcagattctccaaaggtttcccccgaagttatagctgagtataccgttaaagctttgcagc 198  Q
    |||||||| || ||||||||||||||||| |||||||| || ||| | ||||||||| | ||||| ||| | |||||| | ||||||| ||||||||||     
29233581 gaaggcactctcttgaagcctaacatggttacccctggatctgatgcaccaaaggttgcacccgaggttgttgctgagcacaccgttagagctttgcaga 29233482  T
199 gaaccgttccggctgccgttcctgctgttgt 229  Q
    ||||||| || ||||| || || ||||||||    
29233481 gaaccgtacctgctgcagtcccagctgttgt 29233451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 6 - 61
Target Start/End: Original strand, 42028122 - 42028177
Alignment:
6 gatggatctcatgacatcaacaagtgtgccgaggtgactgaacgtgttctagctgc 61  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||    
42028122 gatggatctcatgacatcaacaagtgtgctgaggtgactgaacgtgttctggctgc 42028177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 148
Target Start/End: Complemental strand, 26629803 - 26629700
Alignment:
45 gaacgtgttctagctgcatgctacaaagctttaaacgatcatcatgttctgctggaaggcacccttttgaagcctaacatggtcacccctggttcagatt 144  Q
    ||||| ||||| || ||||| ||||| ||| |||  || ||||||||||| || ||||| || |||||||||||||| ||||| || || || |||||||    
26629803 gaacgcgttcttgcagcatgttacaaggctctaagtgaccatcatgttcttcttgaaggtactcttttgaagcctaatatggttacaccaggatcagatt 26629704  T
145 ctcc 148  Q
    ||||    
26629703 ctcc 26629700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University