View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2733_low_20 (Length: 246)
Name: NF2733_low_20
Description: NF2733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2733_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 60 - 229
Target Start/End: Complemental strand, 29237370 - 29237201
Alignment:
| Q |
60 |
gcatgctacaaagctttaaacgatcatcatgttctgctggaaggcacccttttgaagcctaacatggtcacccctggttcagattctccaaaggtttccc |
159 |
Q |
| |
|
||||||||||| || || || || || ||||| || || |||||||| || ||||||||||||||||| |||||||| || ||| | ||||||||| | | |
|
|
| T |
29237370 |
gcatgctacaaggccttgaatgaccaccatgtcctccttgaaggcactctcttgaagcctaacatggttacccctggatctgatgcaccaaaggttgcac |
29237271 |
T |
|
| Q |
160 |
ccgaagttatagctgagtataccgttaaagctttgcagcgaaccgttccggctgccgttcctgctgttgt |
229 |
Q |
| |
|
|||| ||| | |||||| | ||||||| |||||||||| ||||||| || ||||| || || |||||||| |
|
|
| T |
29237270 |
ccgaggttgttgctgagcacaccgttagagctttgcagagaaccgtacctgctgcagtcccagctgttgt |
29237201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 99 - 229
Target Start/End: Complemental strand, 29233581 - 29233451
Alignment:
| Q |
99 |
gaaggcacccttttgaagcctaacatggtcacccctggttcagattctccaaaggtttcccccgaagttatagctgagtataccgttaaagctttgcagc |
198 |
Q |
| |
|
|||||||| || ||||||||||||||||| |||||||| || ||| | ||||||||| | ||||| ||| | |||||| | ||||||| |||||||||| |
|
|
| T |
29233581 |
gaaggcactctcttgaagcctaacatggttacccctggatctgatgcaccaaaggttgcacccgaggttgttgctgagcacaccgttagagctttgcaga |
29233482 |
T |
|
| Q |
199 |
gaaccgttccggctgccgttcctgctgttgt |
229 |
Q |
| |
|
||||||| || ||||| || || |||||||| |
|
|
| T |
29233481 |
gaaccgtacctgctgcagtcccagctgttgt |
29233451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 6 - 61
Target Start/End: Original strand, 42028122 - 42028177
Alignment:
| Q |
6 |
gatggatctcatgacatcaacaagtgtgccgaggtgactgaacgtgttctagctgc |
61 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
42028122 |
gatggatctcatgacatcaacaagtgtgctgaggtgactgaacgtgttctggctgc |
42028177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 148
Target Start/End: Complemental strand, 26629803 - 26629700
Alignment:
| Q |
45 |
gaacgtgttctagctgcatgctacaaagctttaaacgatcatcatgttctgctggaaggcacccttttgaagcctaacatggtcacccctggttcagatt |
144 |
Q |
| |
|
||||| ||||| || ||||| ||||| ||| ||| || ||||||||||| || ||||| || |||||||||||||| ||||| || || || ||||||| |
|
|
| T |
26629803 |
gaacgcgttcttgcagcatgttacaaggctctaagtgaccatcatgttcttcttgaaggtactcttttgaagcctaatatggttacaccaggatcagatt |
26629704 |
T |
|
| Q |
145 |
ctcc |
148 |
Q |
| |
|
|||| |
|
|
| T |
26629703 |
ctcc |
26629700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University