View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2733_low_22 (Length: 226)
Name: NF2733_low_22
Description: NF2733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2733_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 13 - 185
Target Start/End: Original strand, 14993846 - 14994015
Alignment:
| Q |
13 |
agcacagacacgaaacccgcaactgctactatccatatttttccattaacggattattattttgaatgacaagaaaagtttaacataaatacacatgtaa |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14993846 |
agcacaaacacgaaacccgcaactgctactacccatatttttccattaaca---tattattttgaatgacaagaaaagtttaacataaatacacatgtaa |
14993942 |
T |
 |
| Q |
113 |
ggagtnnnnnnncaaactgtaagtcaaattaaatttaaggaatctcccaaaactaaaatcaaatctttcttta |
185 |
Q |
| |
|
||||| ||| || |||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14993943 |
ggagtaaaaaaataaattgaaagtcaaattgaatttaaggaatctcccaaaactaaaatcaaatcttttttta |
14994015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 207
Target Start/End: Original strand, 17802950 - 17802989
Alignment:
| Q |
168 |
aaatcaaatctttctttaatttgacagccaacagatatta |
207 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17802950 |
aaatcaaatctttctttaatttggcagccaacagatatta |
17802989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University