View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2733_low_8 (Length: 437)
Name: NF2733_low_8
Description: NF2733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2733_low_8 |
 |  |
|
| [»] chr8 (136 HSPs) |
 |  |
|
| [»] chr3 (158 HSPs) |
 |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] chr2 (111 HSPs) |
 |  |
|
| [»] chr7 (144 HSPs) |
 |  |
|
| [»] chr5 (144 HSPs) |
 |  |
|
| [»] chr4 (158 HSPs) |
 |  |
|
| [»] scaffold0022 (2 HSPs) |
 |  |
|
| [»] chr6 (92 HSPs) |
 |  |
|
| [»] scaffold0922 (1 HSPs) |
 |  |
|
| [»] scaffold0606 (1 HSPs) |
 |  |
|
| [»] scaffold0594 (2 HSPs) |
 |  |
|
| [»] scaffold0474 (2 HSPs) |
 |  |
|
| [»] scaffold0370 (4 HSPs) |
 |  |
|
| [»] scaffold0213 (2 HSPs) |
 |  |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0035 (2 HSPs) |
 |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |  |
|
| [»] scaffold0951 (1 HSPs) |
 |  |
|
| [»] scaffold0693 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |  |
|
| [»] scaffold1171 (1 HSPs) |
 |  |
|
| [»] scaffold0777 (1 HSPs) |
 |  |
|
| [»] scaffold0352 (2 HSPs) |
 |  |
|
| [»] scaffold0182 (3 HSPs) |
 |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |
|
| [»] scaffold0014 (3 HSPs) |
 |  |
|
| [»] scaffold0864 (2 HSPs) |
 |  |
|
| [»] scaffold0283 (2 HSPs) |
 |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |
|
| [»] scaffold0272 (3 HSPs) |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0592 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |  |
|
| [»] scaffold0227 (1 HSPs) |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold1067 (2 HSPs) |
 |  |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 51; Significance: 5e-20; HSPs: 136)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 414660 - 414718
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
414660 |
ttttattggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
414718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 39515549 - 39515609
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39515549 |
tttttttttggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
39515609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 7151157 - 7151104
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7151157 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
7151104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 380 - 437
Target Start/End: Complemental strand, 42906693 - 42906636
Alignment:
| Q |
380 |
tttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42906693 |
tttataggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
42906636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 437
Target Start/End: Complemental strand, 5734499 - 5734447
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5734499 |
tggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
5734447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 381 - 437
Target Start/End: Complemental strand, 6107435 - 6107379
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6107435 |
ttattagcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
6107379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 1657698 - 1657647
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1657698 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
1657647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 8870259 - 8870310
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8870259 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
8870310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 378 - 437
Target Start/End: Complemental strand, 14024361 - 14024302
Alignment:
| Q |
378 |
tttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14024361 |
ttttttttggcttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
14024302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 14032036 - 14032087
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14032036 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
14032087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 20095686 - 20095737
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20095686 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
20095737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 384 - 435
Target Start/End: Complemental strand, 20096002 - 20095951
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20096002 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
20095951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 384 - 435
Target Start/End: Complemental strand, 20283990 - 20283939
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20283990 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
20283939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 382 - 437
Target Start/End: Complemental strand, 20814058 - 20814003
Alignment:
| Q |
382 |
tattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
20814058 |
tattggcttaattgcacttttggacccctatctttccaaaacttgcggttatggac |
20814003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 384 - 435
Target Start/End: Complemental strand, 21070618 - 21070567
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21070618 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
21070567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 30359155 - 30359104
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30359155 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
30359104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 30845873 - 30845822
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30845873 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
30845822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 37205854 - 37205803
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37205854 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
37205803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 38593187 - 38593238
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38593187 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
38593238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 383 - 434
Target Start/End: Complemental strand, 40918690 - 40918639
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40918690 |
attggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
40918639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 42267771 - 42267720
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42267771 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
42267720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 437
Target Start/End: Complemental strand, 4167516 - 4167462
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
4167516 |
attggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
4167462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 386 - 436
Target Start/End: Original strand, 6107117 - 6107167
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6107117 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
6107167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 36801390 - 36801448
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
36801390 |
ttttatttgcttaattgcacttttggacccctatctttccacaagttgcggttatggac |
36801448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 381 - 434
Target Start/End: Complemental strand, 2321835 - 2321782
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
2321835 |
ttattggcttaattgcacttttggacccctatctttccaaaagttgtggttatg |
2321782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 377 - 434
Target Start/End: Complemental strand, 4107170 - 4107113
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
4107170 |
tttttttttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
4107113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 379 - 436
Target Start/End: Original strand, 6335325 - 6335382
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
6335325 |
ttttatttgcttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
6335382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 38166486 - 38166535
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38166486 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
38166535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 38166797 - 38166748
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38166797 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
38166748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 39616864 - 39616815
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39616864 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
39616815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 1985879 - 1985831
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1985879 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
1985831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 437
Target Start/End: Complemental strand, 18553285 - 18553233
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18553285 |
tggcttaattgcaattttggacccctatctttccaaaagttgcggttatggac |
18553233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 35735495 - 35735554
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
35735495 |
tttttttttggcttaattgcacttttggaccc-tatctttccaaaagttgcggttatggac |
35735554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 437
Target Start/End: Complemental strand, 39626282 - 39626230
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
39626282 |
tggcttaattgcacttttggacccctatctttccaaaagctgcggttatggac |
39626230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 437
Target Start/End: Complemental strand, 39635832 - 39635780
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
39635832 |
tggcttaattgcacttttggacccctatctttccaaaagctgcggttatggac |
39635780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 414968 - 414917
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
414968 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
414917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 2321516 - 2321567
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
2321516 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
2321567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 4132754 - 4132805
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
4132754 |
ggcttaattgcacttttggatccctatctttccaaaagttgcggttatggac |
4132805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 4133068 - 4133017
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
4133068 |
ggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggac |
4133017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 6014419 - 6014470
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
6014419 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
6014470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 17943358 - 17943409
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
17943358 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
17943409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 388 - 435
Target Start/End: Original strand, 20791018 - 20791065
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20791018 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
20791065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 20820065 - 20820014
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
20820065 |
ggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggac |
20820014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 23234093 - 23234042
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
23234093 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
23234042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 27822875 - 27822926
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
27822875 |
ggcttaattgcacttttggacccctatctttccaaaatttgcggttatggac |
27822926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 436
Target Start/End: Original strand, 30845553 - 30845604
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30845553 |
tggcttaattgtacttttggacccctatctttccaaaagttgcggttatgga |
30845604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 32332140 - 32332191
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
32332140 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttttggac |
32332191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 36226728 - 36226677
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
36226728 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
36226677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 37953374 - 37953425
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
37953374 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
37953425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 42642401 - 42642350
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
42642401 |
ggcttaattgcacttttggacccctatctttccaaaggttgcggttatggac |
42642350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 42906372 - 42906423
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
42906372 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
42906423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 45106435 - 45106486
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
45106435 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
45106486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 382 - 437
Target Start/End: Complemental strand, 45480369 - 45480314
Alignment:
| Q |
382 |
tattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| || |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45480369 |
tattggcttaactgtacttttggacccctatctttccaaaagttgcggttatggac |
45480314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 1657381 - 1657439
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||| |||||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
1657381 |
ttttatttgcttaattgcacttttgaacccctatctttccaaaagttgtggttatggac |
1657439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 437
Target Start/End: Original strand, 6641593 - 6641647
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6641593 |
attgacttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
6641647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 6641913 - 6641863
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
6641913 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
6641863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 14032353 - 14032295
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||| |||||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
14032353 |
ttttatttgcttaattgcacttttgaacccctatctttccaaaagttgtggttatggac |
14032295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Original strand, 15187928 - 15187978
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
15187928 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
15187978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 377 - 434
Target Start/End: Complemental strand, 18531155 - 18531098
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| ||| ||||||| |||||||| |
|
|
| T |
18531155 |
tttttttttggcttaattgcacttttggacccctatctttctaaaagttacggttatg |
18531098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 23233779 - 23233828
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
23233779 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
23233828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 31190641 - 31190690
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
31190641 |
ttggcttaattgcacttttggacccctatctttctaaaagttgcggttat |
31190690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 36788256 - 36788301
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36788256 |
cttaattgcacttttggacccctatctttccaaaagttgcggttat |
36788301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 4147094 - 4147046
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
4147094 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
4147046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 12330076 - 12330124
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
12330076 |
ttaattgcacttttggacccatatctttccaaaagttgcggttatggac |
12330124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 32318819 - 32318771
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
32318819 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
32318771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 37953683 - 37953635
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
37953683 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
37953635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 44886214 - 44886166
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
44886214 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
44886166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 45208979 - 45209027
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
45208979 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
45209027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 994993 - 995044
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
994993 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
995044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 4146785 - 4146836
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
4146785 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
4146836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 6335641 - 6335590
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
6335641 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcgattatggac |
6335590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 8287917 - 8287866
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| |||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
8287917 |
ggcttagttgcacttttggacccctatcttttcaaaagttgcggttatggac |
8287866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 8833942 - 8833993
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
8833942 |
ggcttaattgcacttttggacacctatctttcaaaaagttgcggttatggac |
8833993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 8870574 - 8870523
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
8870574 |
ggcttaattgcatttttgaacccctatctttccaaaagttgcggttatggac |
8870523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 436
Target Start/End: Original strand, 16531239 - 16531298
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
16531239 |
tttttttttggcttaattgtatttttggacccctatcttttcaaaagttgcggttatgga |
16531298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 16531562 - 16531511
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
16531562 |
ggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggac |
16531511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 20813736 - 20813787
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||| |||||||||||| || |||||||||||||||||||| |
|
|
| T |
20813736 |
ggcttaattgcacttgtggacccctatcttttcaaaagttgcggttatggac |
20813787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 20819752 - 20819803
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
20819752 |
ggcttaattgcacttttggaccactatcttttcaaaagttgcggttatggac |
20819803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 27339543 - 27339594
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
27339543 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggttatggac |
27339594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 27873022 - 27872971
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||| ||||||||| ||||||||| |
|
|
| T |
27873022 |
ggcttaattgctcttttggatccctatctttctaaaagttgcagttatggac |
27872971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 39515867 - 39515816
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| ||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
39515867 |
ggcttaattgtacttttggactcctatctttccaaaagttgcggttatggac |
39515816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 388 - 435
Target Start/End: Original strand, 41206164 - 41206211
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
41206164 |
cttaattgcacttttggacccatatctttccaaaagttgcggttatgg |
41206211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 41625460 - 41625511
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
41625460 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
41625511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 42267456 - 42267507
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
42267456 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
42267507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 45209289 - 45209238
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
45209289 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggttatggac |
45209238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 436
Target Start/End: Original strand, 27872710 - 27872760
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
27872710 |
ggcttaattgcacttttggatccctatctttctaaaagttgcggttatgga |
27872760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 389 - 435
Target Start/End: Complemental strand, 41015101 - 41015055
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
41015101 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
41015055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 432
Target Start/End: Complemental strand, 42866406 - 42866360
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||| |
|
|
| T |
42866406 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggtta |
42866360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 432
Target Start/End: Original strand, 43657492 - 43657538
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
43657492 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
43657538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 432
Target Start/End: Complemental strand, 43658494 - 43658448
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
43658494 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
43658448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 995305 - 995256
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
995305 |
cttaattgcacttttggacccctattttttcaaaagttgcggttatggac |
995256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 7653668 - 7653620
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
7653668 |
ggcttaattgcacttttggacccttatc-ttccaaaagttgcggttatgg |
7653620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 8834250 - 8834201
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
8834250 |
cttaattgcacttttggacccctatctttttaaaagttgcggttatggac |
8834201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 27339858 - 27339805
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
27339858 |
ttggcttaattgcatttttggacccctatctttttaaaagttgcggttatggac |
27339805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 28596245 - 28596192
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||| ||||||| ||| |||||||| |||||||||| |
|
|
| T |
28596245 |
ttggcttaattgcacttttggatccctatctttctaaaagttgtggttatggac |
28596192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 389 - 434
Target Start/End: Original strand, 29233545 - 29233590
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||| |||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
29233545 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatg |
29233590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 30358841 - 30358894
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||| | ||| || |||||||||||||||||||| |
|
|
| T |
30358841 |
ttggcttaattgcacttttggacctcgatcttttcaaaagttgcggttatggac |
30358894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 32693027 - 32692978
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
32693027 |
ggcttaattgtacttttggacccctatctttccaaaaattgcggttatgg |
32692978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 389 - 434
Target Start/End: Original strand, 35409716 - 35409761
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||| |||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
35409716 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatg |
35409761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 41206445 - 41206396
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||| ||||||||| || |||||||||||||||||| |
|
|
| T |
41206445 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
41206396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 42363580 - 42363629
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| ||||||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
42363580 |
cttaattgcacttttggacccttatctttccaaaagttgctgttatggac |
42363629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 42525019 - 42524970
Alignment:
| Q |
389 |
ttaattgctcttttggacccc-tatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
42525019 |
ttaattgcacttttggaccccctatctttccaaaagttgcggttatggac |
42524970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 430
Target Start/End: Complemental strand, 6745307 - 6745263
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggt |
430 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||| |
|
|
| T |
6745307 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggt |
6745263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 14024195 - 14024243
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| | |||||||||||||| || |||||||||||||||||||| |
|
|
| T |
14024195 |
ttaattgcacgtttggacccctatctttacaaaagttgcggttatggac |
14024243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 20791311 - 20791263
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| ||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
20791311 |
ggcttaattgcatttttggacctctatctttccaaaagttgcggttatg |
20791263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 25249957 - 25250005
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
25249957 |
ttaattgtacttttggacccctatcttttcaaaagttgcggttatggac |
25250005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 433
Target Start/End: Complemental strand, 25250256 - 25250212
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
25250256 |
ttaattgcacttttggacctctatctttccaaaagttgcggttat |
25250212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 29454346 - 29454395
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
29454346 |
ggcttaattgcacttttggacccctct--ttccaaaagttgcggttatggac |
29454395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 33881397 - 33881349
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
33881397 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggac |
33881349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 37205531 - 37205591
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | ||||||||||| ||||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
37205531 |
ttttttttaggcttaattgcatttttgaacccctatcttttcaaaagttgcggttatggac |
37205591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 39625970 - 39626018
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
39625970 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggac |
39626018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 39635520 - 39635568
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
39635520 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggac |
39635568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 41574462 - 41574414
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
41574462 |
ttaattgcacttttggacccctatctttctaaaagttgcgattatggac |
41574414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 41693365 - 41693317
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||| || |||| |||||||||||||||||||| |
|
|
| T |
41693365 |
ggcttaattgcacttttggatccttatctttccaaaagttgcggttatg |
41693317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 44885907 - 44885955
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
44885907 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
44885955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 432
Target Start/End: Complemental strand, 3345684 - 3345641
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
3345684 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
3345641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 5734184 - 5734235
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
5734184 |
ggcttaattgcatttttgaacccctatcttttcaaaagttgcggttatggac |
5734235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 6014731 - 6014680
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
6014731 |
ggcttaattgcacttttggatccctatctttttaaaagttgcggttatggac |
6014680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 6655591 - 6655540
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||| ||||||| |||||||||||||||| |||||| |
|
|
| T |
6655591 |
ggcttaattgcatttttggatccctatctttccaaaagttgcggtaatggac |
6655540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 6735993 - 6735942
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||| ||||||| |||||||||||||||| |||||| |
|
|
| T |
6735993 |
ggcttaattgcatttttggatccctatctttccaaaagttgcggtaatggac |
6735942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 424
Target Start/End: Complemental strand, 7318949 - 7318910
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagt |
424 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
7318949 |
tggcttaattgcacttttggacccctatctttccaaaagt |
7318910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 29233818 - 29233767
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| || ||||||||||||||||||| |
|
|
| T |
29233818 |
ggcttaattgcacttttggacctctatctttttaaaagttgcggttatggac |
29233767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 31191783 - 31191732
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| || ||||||||||||||||||| |
|
|
| T |
31191783 |
ggcttaattgcacttttggacctctatctttttaaaagttgcggttatggac |
31191732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 33947044 - 33947095
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||| | |||||||| |
|
|
| T |
33947044 |
ggcttaattgtacttttggacccctatctttccaaaagttgagattatggac |
33947095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 37639507 - 37639558
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||| |||| ||||| |
|
|
| T |
37639507 |
ggcttaattgcacttttggacccctatcttttcaaaagttgaggttttggac |
37639558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 433
Target Start/End: Complemental strand, 38593498 - 38593451
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||| |||| ||||||||||||||||||| |
|
|
| T |
38593498 |
ggcttaattgcacttttggacctctatatttccaaaagttgcggttat |
38593451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 391 - 432
Target Start/End: Original strand, 3340071 - 3340112
Alignment:
| Q |
391 |
aattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
|||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
3340071 |
aattgcacttttggacccctaactttccaaaagttgcggtta |
3340112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 431
Target Start/End: Complemental strand, 41554900 - 41554855
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtt |
431 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
41554900 |
ggcttaattgcacttttggatccctatctttctaaaagttgcggtt |
41554855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 389 - 434
Target Start/End: Complemental strand, 42930928 - 42930883
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||| ||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
42930928 |
ttaattgcactttttgacccctatcttttcaaaagttgcggttatg |
42930883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 405 - 437
Target Start/End: Original strand, 3411420 - 3411452
Alignment:
| Q |
405 |
acccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
3411420 |
acccctatctttccaaaagttgcggttatggac |
3411452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 17943652 - 17943604
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||| |||||| |||| ||||||||||| ||||||||||| |||||||| |
|
|
| T |
17943652 |
ggctaaattgcactttaggacccctatctttccaaaagttacggttatg |
17943604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 437
Target Start/End: Original strand, 20056410 - 20056462
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| ||||||||||| |||| || || |||||||||||||||| |
|
|
| T |
20056410 |
tggcttaattgcacttttggacccttatctttttaatagttgcggttatggac |
20056462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 33877810 - 33877758
Alignment:
| Q |
386 |
ggcttaattgctcttttgga-cccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| |||||||| || ||||||||| |||||||||| |
|
|
| T |
33877810 |
ggcttaattgcacttttggaccccctatcttttcaaaagttgtggttatggac |
33877758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 37277770 - 37277722
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||| |||||||||| |
|
|
| T |
37277770 |
ttaattgcacttttggacccctatcttttcaaaagttatggttatggac |
37277722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 42363882 - 42363834
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
42363882 |
ttaattgcacttttggacccctttctttttaaaagttgcggttatggac |
42363834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 45516233 - 45516185
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||| |||||| || ||||||||||||||||| |
|
|
| T |
45516233 |
ggcttaattgcatttttggactcctatcttttcaaaagttgcggttatg |
45516185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 5e-20; HSPs: 158)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 44184291 - 44184233
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44184291 |
ttttattggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
44184233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 27857457 - 27857397
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27857457 |
tttttttttggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
27857397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 53192435 - 53192375
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53192435 |
tttttttttggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
53192375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 378 - 437
Target Start/End: Original strand, 22202476 - 22202535
Alignment:
| Q |
378 |
tttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22202476 |
tttttaatggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
22202535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 377 - 435
Target Start/End: Complemental strand, 25053906 - 25053848
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25053906 |
tttttttttggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
25053848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 3212467 - 3212414
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3212467 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
3212414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 47530337 - 47530390
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47530337 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
47530390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 381 - 437
Target Start/End: Original strand, 8313944 - 8314000
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8313944 |
ttataggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
8314000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 42230353 - 42230293
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| || ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42230353 |
tttttaataggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
42230293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 2239543 - 2239492
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2239543 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
2239492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 10864115 - 10864166
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10864115 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
10864166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 17916396 - 17916345
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17916396 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
17916345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 19391638 - 19391689
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19391638 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
19391689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 19392016 - 19391965
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19392016 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
19391965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 19914785 - 19914734
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19914785 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
19914734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 26494685 - 26494736
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26494685 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
26494736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 27748556 - 27748505
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27748556 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
27748505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 27766518 - 27766569
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27766518 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
27766569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 27766830 - 27766779
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27766830 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
27766779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 28964153 - 28964204
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28964153 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
28964204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 37182004 - 37182055
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37182004 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
37182055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 44177288 - 44177339
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44177288 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
44177339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 44183972 - 44184023
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44183972 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
44184023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 44895961 - 44895910
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44895961 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
44895910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 45743899 - 45743950
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45743899 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
45743950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 47530653 - 47530602
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47530653 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
47530602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 52916859 - 52916910
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52916859 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
52916910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 53192114 - 53192165
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53192114 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
53192165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 53532119 - 53532068
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53532119 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
53532068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 257756 - 257698
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
257756 |
ttttataggcttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
257698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 386 - 436
Target Start/End: Original strand, 27748244 - 27748294
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27748244 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
27748294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 436
Target Start/End: Original strand, 49997651 - 49997705
Alignment:
| Q |
382 |
tattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49997651 |
tattggcttaattgcacttttggacccctatttttccaaaagttgcggttatgga |
49997705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 2119029 - 2118976
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
2119029 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
2118976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 5577248 - 5577195
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
5577248 |
ttggcttaattgcacttttggacccctatctttccaaaagttgaggttatggac |
5577195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 12881235 - 12881284
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12881235 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
12881284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 12881528 - 12881479
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12881528 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
12881479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 382 - 435
Target Start/End: Original strand, 20982276 - 20982329
Alignment:
| Q |
382 |
tattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
20982276 |
tattggcttaattgcacttttggacccctatctttctaaaagttgcggttatgg |
20982329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 20982572 - 20982523
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20982572 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
20982523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 30200414 - 30200467
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| |||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30200414 |
ttgggttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
30200467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 41282162 - 41282109
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
41282162 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
41282109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 42465691 - 42465740
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42465691 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
42465740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 45760548 - 45760495
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
45760548 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
45760495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 47423441 - 47423392
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47423441 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
47423392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 436
Target Start/End: Complemental strand, 17483873 - 17483821
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
17483873 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
17483821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 33252795 - 33252747
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33252795 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
33252747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 36441473 - 36441533
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
36441473 |
tttttttttggcttaattgcacttttggactcctatctttctaaaagttgcggttatggac |
36441533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 436
Target Start/End: Complemental strand, 53191278 - 53191226
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53191278 |
ttggcttaattgcatttttggacccctatctttccaaaagttgcggttatgga |
53191226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 53422092 - 53422140
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53422092 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
53422140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 3384301 - 3384250
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
3384301 |
ggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggac |
3384250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 9633711 - 9633660
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
9633711 |
ggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggac |
9633660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 19914476 - 19914527
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
19914476 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
19914527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 25126311 - 25126260
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
25126311 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
25126260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 27984445 - 27984394
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| | |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27984445 |
ggcttaattacacttttggacccctatctttccaaaagttgcggttatggac |
27984394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 28964467 - 28964416
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
28964467 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
28964416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 31117620 - 31117671
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
31117620 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
31117671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 32205160 - 32205109
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
32205160 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
32205109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 32508232 - 32508181
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
32508232 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
32508181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 33576722 - 33576671
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
33576722 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
33576671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 33621866 - 33621917
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
33621866 |
ggcttaattgcacttttggacccctatctttacaaaagttgcggttatggac |
33621917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 41281845 - 41281896
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
41281845 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
41281896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 41722054 - 41722105
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41722054 |
ggcttaattgcacttttggacccctatatttccaaaagttgcggttatggac |
41722105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 47943773 - 47943722
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
47943773 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
47943722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 389 - 436
Target Start/End: Original strand, 53190964 - 53191011
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53190964 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
53191011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 374 - 437
Target Start/End: Original strand, 2239213 - 2239278
Alignment:
| Q |
374 |
ttcttttttatt--ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
2239213 |
ttcttttttattaaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
2239278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 387 - 437
Target Start/End: Complemental strand, 31869507 - 31869457
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
31869507 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttttggac |
31869457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 38511652 - 38511710
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
38511652 |
tttttttggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
38511710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Original strand, 42230033 - 42230083
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
42230033 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatgga |
42230083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 44177605 - 44177547
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||| |||||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
44177605 |
ttttatttgcttaattgcacttttgaacccctatctttccaaaagttgtggttatggac |
44177547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 51213300 - 51213358
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
51213300 |
tttttttggcttaattgcacttttggacccctatcttttcaaaagttgcgattatggac |
51213358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 388 - 434
Target Start/End: Complemental strand, 51843113 - 51843067
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51843113 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatg |
51843067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 52917632 - 52917582
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
52917632 |
ggcttaattgcacttttgggcccctatctttccaaaagttgcggttatgga |
52917582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 787097 - 787150
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
787097 |
ttggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
787150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 5154096 - 5154043
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
5154096 |
ttggcttaattgcacttttggaccactatttttccaaaagttgcggttatggac |
5154043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 7858275 - 7858226
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
7858275 |
ggcttaattgcacttttggatccctatctttccaaaagttgcggttatgg |
7858226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 8727915 - 8727964
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
8727915 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
8727964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 9079802 - 9079851
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
9079802 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
9079851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 17483559 - 17483612
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
17483559 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
17483612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 21841727 - 21841776
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
21841727 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatgg |
21841776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 2711701 - 2711749
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
2711701 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
2711749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 10864432 - 10864384
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
10864432 |
ggcttaattgcacttttggacccctatctttccaaaagttgcagttatg |
10864384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 436
Target Start/End: Original strand, 27984137 - 27984189
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
27984137 |
ttggcttaattgcacttttggacccctatctttttaaaagttgcggttatgga |
27984189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 29168732 - 29168780
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
29168732 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
29168780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 33576410 - 33576458
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
33576410 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatggac |
33576458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 40082503 - 40082455
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
40082503 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
40082455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 381 - 437
Target Start/End: Original strand, 47943454 - 47943510
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
47943454 |
ttataggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggac |
47943510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 387 - 435
Target Start/End: Complemental strand, 52613634 - 52613586
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
52613634 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
52613586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 2118713 - 2118764
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
2118713 |
ggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggac |
2118764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 9153477 - 9153528
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
9153477 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttaaggac |
9153528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 11963038 - 11962987
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
11963038 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggttacggac |
11962987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 28097417 - 28097468
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
28097417 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
28097468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 28097737 - 28097686
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| | |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
28097737 |
ggcttaattccacttttggacccctatcttttcaaaagttgcggttatggac |
28097686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 30200727 - 30200676
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
30200727 |
ggcttaattgcacttttagactcctatctttccaaaagttgcggttatggac |
30200676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 30761113 - 30761062
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
30761113 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
30761062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 32204848 - 32204899
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
32204848 |
ggcttaattgcacttttggacctctatctttccaaaagttgcgcttatggac |
32204899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 32507927 - 32507978
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
32507927 |
ggcttaattgcacttttggacccctattttttcaaaagttgcggttatggac |
32507978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 36373858 - 36373807
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
36373858 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
36373807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 433
Target Start/End: Complemental strand, 38511970 - 38511923
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
38511970 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
38511923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 41223513 - 41223560
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
41223513 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
41223560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 44624539 - 44624488
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
44624539 |
ggcttaattgcacttttggacccctatcttttcaaaagttacggttatggac |
44624488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 45744212 - 45744161
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
45744212 |
ggcttaattgcacttttggatctctatctttccaaaagttgcggttatggac |
45744161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 45760232 - 45760283
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
45760232 |
ggcttaattgcactttttgacctctatctttccaaaagttgcggttatggac |
45760283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 389 - 436
Target Start/End: Original strand, 47722152 - 47722199
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||| |||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
47722152 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatgga |
47722199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 49997969 - 49997918
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
49997969 |
ggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggac |
49997918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 50033554 - 50033503
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
50033554 |
ggcttaattgcacttttggacccctatcttttcaaaggttgcggttatggac |
50033503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 53531806 - 53531857
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
53531806 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttaaggac |
53531857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 432
Target Start/End: Original strand, 54717164 - 54717211
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
|||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
54717164 |
tggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
54717211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 388 - 434
Target Start/End: Complemental strand, 27719997 - 27719951
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
27719997 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
27719951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 432
Target Start/End: Complemental strand, 54718161 - 54718115
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
54718161 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
54718115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 787411 - 787362
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
787411 |
cttaattgcacttttggatccctatttttccaaaagttgcggttatggac |
787362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 377 - 434
Target Start/End: Original strand, 25782644 - 25782701
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||| | ||||||||||| ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
25782644 |
ttttttttaggcttaattgcactttttgacccctatttttccaaaagttgcggttatg |
25782701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 27448814 - 27448863
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||| |||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
27448814 |
ggcttaattgtacttttgaacccctatctttccaaaagttgcggttatgg |
27448863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 33622177 - 33622128
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
33622177 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
33622128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 33933683 - 33933634
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||||| |||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33933683 |
ttggcttaattgcaattttggccccctatctttccaaaagttgcggttat |
33933634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 378 - 434
Target Start/End: Original strand, 40082203 - 40082260
Alignment:
| Q |
378 |
tttttatt-ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| |||||| || ||||||||||||||||| |
|
|
| T |
40082203 |
tttttattaggcttaattgcacttttggacacctatcttttcaaaagttgcggttatg |
40082260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 41722299 - 41722246
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||| ||||||||| || ||||||||| |||||||||| |
|
|
| T |
41722299 |
ttggcttaattgcacttttgaacccctatcttttcaaaagttgtggttatggac |
41722246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 46934301 - 46934252
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
46934301 |
ggcttaattgcacttttggccccctatctttccaaaagttgcgattatgg |
46934252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 2205540 - 2205588
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
2205540 |
ttaattgcacttttgaacccctatctttccaaaagttgtggttatggac |
2205588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 433
Target Start/End: Complemental strand, 2205838 - 2205794
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| |||||||||| |
|
|
| T |
2205838 |
ttaattgcacttttggacccctatctttccaaaaattgcggttat |
2205794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 7818936 - 7818984
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7818936 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggac |
7818984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 9630768 - 9630816
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||| ||||||| || ||||||||||||||||| |
|
|
| T |
9630768 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatg |
9630816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 399 - 435
Target Start/End: Original strand, 21689943 - 21689979
Alignment:
| Q |
399 |
ttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21689943 |
ttttggacccctatctttccaaaagttgcggttatgg |
21689979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 36017074 - 36017026
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||| | ||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
36017074 |
ggcttaatttcacttttagacccctatctttccaaaagttgcggttatg |
36017026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 37182321 - 37182261
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | ||||||||||| || |||||||||||| || |||||||||||||||||||| |
|
|
| T |
37182321 |
ttttttttaggcttaattgcggttatggacccctatcttttcaaaagttgcggttatggac |
37182261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 387 - 431
Target Start/End: Original strand, 44701816 - 44701860
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggtt |
431 |
Q |
| |
|
|||||||||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
44701816 |
gcttaattgcacttttggccccctatctttccaaaagttgcggtt |
44701860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 51336890 - 51336938
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| ||||||||| |||||| || ||||||||||||||||| |
|
|
| T |
51336890 |
ggcttaattgcacttttggactcctatcttttcaaaagttgcggttatg |
51336938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 51842792 - 51842852
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| ||||| || | ||||| || |||||||||||||||||||| |
|
|
| T |
51842792 |
tttttttttggcttaattgcacttttagatctctatcttttcaaaagttgcggttatggac |
51842852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 391 - 434
Target Start/End: Original strand, 3212158 - 3212201
Alignment:
| Q |
391 |
aattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
3212158 |
aattgcacttttggacccctatctttctaaaagttgcggttatg |
3212201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 11961865 - 11961916
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||| | || ||||||||||||||| |||| |
|
|
| T |
11961865 |
ggcttaattgcacttttggacccctaacttttcaaaagttgcggttacggac |
11961916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 24636350 - 24636401
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
24636350 |
ggcttaattgtacttttggacccctatcttttcaaaagttgtggttatggac |
24636401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 25782966 - 25782915
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| ||| | |||| ||||||||||||||||||||||| |
|
|
| T |
25782966 |
ggcttaattgcacttttagacacttatctttccaaaagttgcggttatggac |
25782915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 32459096 - 32459045
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
32459096 |
ggcttaattgcatttttggatctctatctttccaaaagttgcggttatggac |
32459045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 33252484 - 33252535
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
33252484 |
ggcttaattgtacttttggacccctatctttctaaaagttgcgattatggac |
33252535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 383 - 434
Target Start/End: Complemental strand, 43679018 - 43678967
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
43679018 |
attggcttaattgcacttttggacacctatattttcaaaagttgcggttatg |
43678967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 44895649 - 44895700
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||| |||||||| |
|
|
| T |
44895649 |
ggcttaattgcacttttggacccctatctttttaaaagttgcgattatggac |
44895700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 436
Target Start/End: Original strand, 50033312 - 50033363
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||||||| ||||| |||| ||||| ||||||||||| |||||||||| |
|
|
| T |
50033312 |
tggcttaattgcacttttagacctctatctttccaaaagttacggttatgga |
50033363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 51214472 - 51214421
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| || ||||||||||||||||||| |
|
|
| T |
51214472 |
ggcttaattgcacttttggacctctatctttttaaaagttgcggttatggac |
51214421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 400 - 434
Target Start/End: Original strand, 14015178 - 14015212
Alignment:
| Q |
400 |
tttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
14015178 |
tttggacccctatctttccaaaagttgcggttatg |
14015212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 14015458 - 14015408
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||| || |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
14015458 |
ttggcttaagtgtacttttggacccctatcttttcaaaagttgcggttatg |
14015408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 424
Target Start/End: Original strand, 14904442 - 14904480
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagt |
424 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
14904442 |
ggcttaattgcacttttggacccctatctttccaaaagt |
14904480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 437
Target Start/End: Complemental strand, 36441636 - 36441586
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||| | ||||||| || |||||||||||||||||||| |
|
|
| T |
36441636 |
gcttaattgcacttttgaatccctatcttttcaaaagttgcggttatggac |
36441586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 389 - 435
Target Start/End: Original strand, 47423150 - 47423196
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| ||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
47423150 |
ttaattgcacttttggacccttatcttttcaaaagttgcggttatgg |
47423196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 428
Target Start/End: Original strand, 53764575 - 53764617
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcg |
428 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
53764575 |
ggcttaattgcacttttggccccctatctttccaaaagttgcg |
53764617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 9153788 - 9153739
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| ||||||||| |||||| ||| ||||||| ||||||||||| |
|
|
| T |
9153788 |
cttaattgcacttttggactcctatctttctaaaagttacggttatggac |
9153739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 14133640 - 14133689
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||| |||| ||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
14133640 |
ggcttagttgcactttttgacccctatctttccaaaacttgcggttatgg |
14133689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 398 - 435
Target Start/End: Complemental strand, 14133922 - 14133885
Alignment:
| Q |
398 |
cttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
14133922 |
cttttggacccctatctttccaaaagttgtggttatgg |
14133885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 21690182 - 21690133
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
21690182 |
ggcttaattgcacttttgcccccctatctttccaaaagttacggttatgg |
21690133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 21842024 - 21841975
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||| |||| ||||| || |||||||||||||||||| |
|
|
| T |
21842024 |
ggcttaattgcacttttagacctctatcttttcaaaagttgcggttatgg |
21841975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 31577731 - 31577682
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||| |||||||||| |
|
|
| T |
31577731 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggac |
31577682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 41223824 - 41223775
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||| |||||||||| |
|
|
| T |
41223824 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggac |
41223775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 389 - 434
Target Start/End: Original strand, 49859528 - 49859573
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||| ||||||||| |||||| ||| |||||||||||||||| |
|
|
| T |
49859528 |
ttaattgcacttttggactcctatctttctaaaagttgcggttatg |
49859573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 5576933 - 5576981
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
5576933 |
ggcttaattgtacttttggacccctatctttttaaaagttgcggttatg |
5576981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 7857981 - 7858029
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||| |||||||||||||||| || |||||||||||| |||| |
|
|
| T |
7857981 |
ggcttaattgtacttttggacccctatcttttcaaaagttgcggctatg |
7858029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 425
Target Start/End: Complemental strand, 8728222 - 8728186
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagtt |
425 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
8728222 |
ttaattgcacttttggacccctatctttccaaaagtt |
8728186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 425
Target Start/End: Complemental strand, 9080109 - 9080073
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagtt |
425 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
9080109 |
ttaattgcacttttggacccctatctttccaaaagtt |
9080073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 10439590 - 10439542
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
10439590 |
ttaattgcatttttggacccttatcttttcaaaagttgcggttatggac |
10439542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 433
Target Start/End: Original strand, 32458782 - 32458826
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
32458782 |
ttaattgcatttttggactcctatctttccaaaagttgcggttat |
32458826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 42465983 - 42465935
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||| ||| | ||| |||||||||||||||||||| |
|
|
| T |
42465983 |
ggcttaattgcacttttgaacctcaatctttccaaaagttgcggttatg |
42465935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 400 - 436
Target Start/End: Original strand, 48160497 - 48160533
Alignment:
| Q |
400 |
tttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| |
|
|
| T |
48160497 |
tttggacccctatcttttcaaaagttgcggttatgga |
48160533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 2e-19; HSPs: 157)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 24 - 245
Target Start/End: Complemental strand, 26629551 - 26629330
Alignment:
| Q |
24 |
ggaaagaagccgtggggactttctttctcttttggaagagcacttcagcagagtactctcaaggcatgggctgggaaagatgaaaacattaagaaggctc |
123 |
Q |
| |
|
||||||||||| ||| ||| | ||||||| |||||| ||||||||||| |||||||| |||||||||| ||| ||||||||||||||| ||||||| |
|
|
| T |
26629551 |
ggaaagaagccttggactcttacattctcttatggaagggcacttcagcaaagtactcttaaggcatggggtggaaaagatgaaaacattcctaaggctc |
26629452 |
T |
 |
| Q |
124 |
aggatgcattcatctccaggtgcagggctaactcacatgcaactttgggaacctataaaggtgatgctaccctgggtgaaggtgcctctgagtctctcca |
223 |
Q |
| |
|
| | |||||| | ||||| | || || ||| | |||||| | ||||| ||| ||||| |||||| ||| ||||| ||||| || |||||||| || |
|
|
| T |
26629451 |
aagctgcattgcttgttaggtgtaaagcaaattcagaagcaactcttggaacttatcaaggtaatgctaaccttggtgatggtgcttcggagtctcttca |
26629352 |
T |
 |
| Q |
224 |
tgtcaaggattacaaatactaa |
245 |
Q |
| |
|
||| ||||| |||||||||||| |
|
|
| T |
26629351 |
tgttaaggactacaaatactaa |
26629330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 32341486 - 32341546
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32341486 |
tttttttttggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
32341546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 382 - 437
Target Start/End: Complemental strand, 23793099 - 23793044
Alignment:
| Q |
382 |
tattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23793099 |
tattggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
23793044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 380 - 434
Target Start/End: Complemental strand, 26435009 - 26434955
Alignment:
| Q |
380 |
tttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26435009 |
tttattggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
26434955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 9058164 - 9058217
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9058164 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
9058217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 42407200 - 42407147
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42407200 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
42407147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 436
Target Start/End: Original strand, 6182980 - 6183032
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6182980 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
6183032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 6491738 - 6491678
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
6491738 |
tttttttttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
6491678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 11204498 - 11204558
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11204498 |
ttttttttaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
11204558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 8774298 - 8774349
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8774298 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
8774349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 9517250 - 9517301
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
9517250 |
ggcttaattgctcttttggacccctatcttttcaaaagttgcggttatggac |
9517301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 11018401 - 11018452
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11018401 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
11018452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 11052210 - 11052159
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11052210 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
11052159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 15161611 - 15161560
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15161611 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
15161560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 20596176 - 20596125
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20596176 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
20596125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 23342274 - 23342223
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23342274 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
23342223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 23356693 - 23356744
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23356693 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
23356744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 26861274 - 26861325
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26861274 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
26861325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 45885262 - 45885211
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45885262 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
45885211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 922476 - 922426
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
922476 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
922426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 387 - 437
Target Start/End: Complemental strand, 25098442 - 25098392
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25098442 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
25098392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 27396839 - 27396789
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27396839 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
27396789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 386 - 436
Target Start/End: Original strand, 43914578 - 43914628
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43914578 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
43914628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 2371175 - 2371228
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
2371175 |
ttggcttaattgcacttttggacccctatctttcaaaaagttgcggttatggac |
2371228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 3263998 - 3264051
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
3263998 |
ttggcttaattgcacttttggacccctatctttccaaaagttacggttatggac |
3264051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 8770778 - 8770725
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8770778 |
ttggcttaattgcacttttggacccctatttttccaaaagttgcggttatggac |
8770725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 13791890 - 13791837
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
13791890 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
13791837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 382 - 435
Target Start/End: Original strand, 18589845 - 18589898
Alignment:
| Q |
382 |
tattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
18589845 |
tattggcttaattgcacttttggacctctatctttccaaaagttgcggttatgg |
18589898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 38622718 - 38622665
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
38622718 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
38622665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 45664453 - 45664404
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45664453 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
45664404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 47113390 - 47113439
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47113390 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
47113439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 52143163 - 52143216
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| |||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52143163 |
ttggtttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
52143216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 52149829 - 52149776
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
52149829 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
52149776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 52233431 - 52233480
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52233431 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
52233480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 11204809 - 11204761
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11204809 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
11204761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 28503458 - 28503398
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
28503458 |
tttttttttggcttaattgcacttttggacccctatcttttcaaaagttacggttatggac |
28503398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 436
Target Start/End: Original strand, 30294868 - 30294920
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
30294868 |
ttggcttaattgcacttttggacccctatctttctaaaagttgcggttatgga |
30294920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 381 - 437
Target Start/End: Original strand, 31797059 - 31797115
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
31797059 |
ttataggcttaattgcacttttggacccctatctttccaaaaattgcggttatggac |
31797115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 32558215 - 32558263
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32558215 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
32558263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 437
Target Start/End: Complemental strand, 37029242 - 37029190
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
37029242 |
tggcttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
37029190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 39427735 - 39427675
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39427735 |
ttttttttaggcttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
39427675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 7598609 - 7598660
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
7598609 |
ggcttaattgcacttttggacccatatctttccaaaagttgcggttatggac |
7598660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 8770463 - 8770514
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
8770463 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
8770514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 11018715 - 11018664
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
11018715 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
11018664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 11051896 - 11051943
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11051896 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
11051943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 12690021 - 12690072
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
12690021 |
ggcttaattgcacttttggacccctatctttccaaaagttgaggttatggac |
12690072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 15161297 - 15161348
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
15161297 |
ggcttaattgcacttttggacccatatctttccaaaagttgcggttatggac |
15161348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 20017690 - 20017639
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
20017690 |
ggcttaattgcacttttggacccctatctttccaaaagttgcgtttatggac |
20017639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 22204305 - 22204356
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
22204305 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
22204356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 22204619 - 22204568
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
22204619 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
22204568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 23341964 - 23342015
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
23341964 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
23342015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 29794693 - 29794744
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
29794693 |
ggcttaattgcacttttggacccctatctttccaaaagttgcagttatggac |
29794744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 30288176 - 30288227
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
30288176 |
ggcttaattgcacttttggacccctatctttccagaagttgcggttatggac |
30288227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 32341805 - 32341754
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
32341805 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
32341754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 45012632 - 45012679
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45012632 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
45012679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 45884948 - 45884999
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
45884948 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
45884999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 46320989 - 46320938
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
46320989 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
46320938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 52143478 - 52143427
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
52143478 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
52143427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 22075667 - 22075617
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
22075667 |
attggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
22075617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 389 - 435
Target Start/End: Original strand, 36230555 - 36230601
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36230555 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
36230601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Original strand, 39427411 - 39427461
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
39427411 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
39427461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 49056121 - 49056175
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccc-tatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
49056121 |
ttggcttaattgcacttttggaccccctatctttccaaaagttgcggttatggac |
49056175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 2371492 - 2371439
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
2371492 |
ttggcttaattgcacttttggacccctatcttttaaaaagttgcggttatggac |
2371439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 6183297 - 6183244
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
6183297 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttaaggac |
6183244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 379 - 436
Target Start/End: Complemental strand, 8029277 - 8029220
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||| |||||||||| |||||||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
8029277 |
ttttatttgcttaattgcacttttggatccctatctttccaaaagttgcagttatgga |
8029220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 10279990 - 10279941
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
10279990 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgg |
10279941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 14460303 - 14460352
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
14460303 |
cttaattgcacttttggacccctatctttccaaaagttgcagttatggac |
14460352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 21727926 - 21727877
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
21727926 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
21727877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 34988397 - 34988348
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
34988397 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggac |
34988348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 392 - 437
Target Start/End: Complemental strand, 36139664 - 36139619
Alignment:
| Q |
392 |
attgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36139664 |
attgcacttttggacccctatctttccaaaagttgcggttatggac |
36139619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 40618730 - 40618779
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40618730 |
ggcttaattgcacttttggacccctatatttccaaaagttgcggttatgg |
40618779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 44846908 - 44846969
Alignment:
| Q |
377 |
ttttttatt-ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
44846908 |
ttttttattaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
44846969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 49227431 - 49227378
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||| | |||||||||| |||||||||||| |
|
|
| T |
49227431 |
ttggcttaattgcacttttggacccctaactttccaaaagtcgcggttatggac |
49227378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 381 - 437
Target Start/End: Original strand, 6809063 - 6809119
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
6809063 |
ttataggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
6809119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 8535519 - 8535579
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
8535519 |
ttttttattggcttaactgcacttttggacccctatttttctaaaagttgtggttatggac |
8535579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 8535826 - 8535778
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
8535826 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggac |
8535778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 8600758 - 8600818
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
8600758 |
ttttttattggcttaactgcacttttggacccctatttttctaaaagttgtggttatggac |
8600818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 8601065 - 8601017
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
8601065 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggac |
8601017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 19830421 - 19830373
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
19830421 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatggac |
19830373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 20224398 - 20224338
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | |||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
20224398 |
ttttttctaggcttaattgtacttttggacccctatcttttcaaaagttgcggttatggac |
20224338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 20359308 - 20359260
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20359308 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
20359260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 20551662 - 20551710
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20551662 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
20551710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 437
Target Start/End: Original strand, 23792779 - 23792831
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| | ||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
23792779 |
tggcttaattacacttttggacacctatctttccaaaagttgcggttatggac |
23792831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 25820101 - 25820161
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| || |||||||||| |||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
25820101 |
tttttttttagcttaattgcacttttggacccctaactttccaaaagttgcggttacggac |
25820161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 36139369 - 36139417
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
36139369 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggac |
36139417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 40355851 - 40355899
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
40355851 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
40355899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 383 - 435
Target Start/End: Complemental strand, 40815182 - 40815130
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
40815182 |
attggcttaattgcacttttggacctctatcttttcaaaagttgcggttatgg |
40815130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 379 - 435
Target Start/End: Complemental strand, 43670634 - 43670578
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||| ||||||||||||| | ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43670634 |
tttttttggcttaattgcacatttggacccctatatttccaaaagttgcggttatgg |
43670578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 43677103 - 43677151
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
43677103 |
ggcttaattgcacttttggatccctatctttccaaaagttgcggttatg |
43677151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 43914902 - 43914842
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
43914902 |
ttttttttaggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
43914842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 49056436 - 49056384
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccc-tatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
49056436 |
ggcttaattgcacttttggaccccctatctttccaaaagttgcggttatggac |
49056384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 52149520 - 52149568
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
52149520 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
52149568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 14740 - 14791
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
14740 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
14791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 389 - 436
Target Start/End: Complemental strand, 1480555 - 1480508
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||| |||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
1480555 |
ttaattgcacttttgtacccctatctttccaaaagttgcggttatgga |
1480508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 7598919 - 7598868
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
7598919 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
7598868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 8028960 - 8029011
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
8028960 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
8029011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 12071644 - 12071695
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| | |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
12071644 |
ggcttaattacacttttggacccctatctttcaaaaagttgcggttatggac |
12071695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 20471414 - 20471465
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
20471414 |
ggcttaattgcacttttagacctctatctttccaaaagttgcggttatggac |
20471465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 20471725 - 20471674
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
20471725 |
ggcttaattgcatttttgaacccctatctttccaaaagttgcggttatggac |
20471674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 20559812 - 20559863
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
20559812 |
ggcttaattgcatttttgaacccctatctttccaaaagttgcggttatggac |
20559863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 20560123 - 20560072
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
20560123 |
ggcttaattgcacttttagacctctatctttccaaaagttgcggttatggac |
20560072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 390 - 437
Target Start/End: Complemental strand, 23357003 - 23356956
Alignment:
| Q |
390 |
taattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
23357003 |
taattgcacttttggacccctatcttttcaaaagttgcggttatggac |
23356956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 25820866 - 25820815
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
25820866 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggttacggac |
25820815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 390 - 437
Target Start/End: Complemental strand, 29795003 - 29794956
Alignment:
| Q |
390 |
taattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
29795003 |
taattgcacttttggacccctatcttttcaaaagttgcggttatggac |
29794956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 436
Target Start/End: Complemental strand, 33811747 - 33811688
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
33811747 |
ttttttttaggcttaattgcatttttggacccctatctttccaaaagttgcggtgatgga |
33811688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 436
Target Start/End: Complemental strand, 33871217 - 33871158
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
33871217 |
ttttttttaggcttaattgcatttttggacccctatctttccaaaagttgcggtgatgga |
33871158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 37028928 - 37028979
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
37028928 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggac |
37028979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 436
Target Start/End: Original strand, 41585276 - 41585335
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||||||||||||||| ||||||| | ||||| || ||||||||||||||||||| |
|
|
| T |
41585276 |
ttttttattggcttaattgcatttttggatctctatcttttcaaaagttgcggttatgga |
41585335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 42406883 - 42406934
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
42406883 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
42406934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 47113700 - 47113649
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
47113700 |
ggcttaattgcacttttggacccctatcttttcaaaatttgcggttatggac |
47113649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 437
Target Start/End: Original strand, 20224079 - 20224129
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| ||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
20224079 |
gcttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
20224129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 435
Target Start/End: Original strand, 40814886 - 40814935
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
40814886 |
tggcttaattgcacttttggaccc-tatctttccaaaagttgcggttatgg |
40814935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 436
Target Start/End: Original strand, 46320676 - 46320726
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| ||||||||| |||||| || ||||||||||||||||||| |
|
|
| T |
46320676 |
ggcttaattgcacttttggactcctatcttttcaaaagttgcggttatgga |
46320726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 4243128 - 4243181
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
4243128 |
ttggtttaattgtacttttggacccctatctttctaaaagttgcggttatggac |
4243181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 434
Target Start/End: Complemental strand, 8774611 - 8774562
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||||| ||||||||||| |||| ||||||||||||| |||||| |
|
|
| T |
8774611 |
tggcttaattgcacttttggacccttatctttccaaaagttgcagttatg |
8774562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 12071960 - 12071911
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||||| |||||||| | ||||| ||||||||||||||||||| |
|
|
| T |
12071960 |
ttggcttaattgcacttttggatctctatctttccaaaagttgcggttat |
12071911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 389 - 434
Target Start/End: Original strand, 21727615 - 21727660
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
21727615 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatg |
21727660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 434
Target Start/End: Original strand, 27855562 - 27855611
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||||| |||||| ||||||||| || ||||||||||||||||| |
|
|
| T |
27855562 |
tggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
27855611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 45680093 - 45680142
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
45680093 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
45680142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 47764089 - 47764142
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
47764089 |
ttggcttaattgcacttttggacctctattttttcaaaagttgcggttatggac |
47764142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 6491416 - 6491464
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
6491416 |
ggcttaattgcacttttggacctctatcttttcaaaagttgcggttatg |
6491464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 9053716 - 9053664
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccc-tatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
9053716 |
ggcttaattgcacttttggaccccctatcttttcaaaagttgcggttatggac |
9053664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 9517556 - 9517508
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
9517556 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatggac |
9517508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 13791579 - 13791627
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| ||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
13791579 |
ttaattgtacttttggactcctatctttccaaaagttgcggttatggac |
13791627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 14460612 - 14460564
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
14460612 |
ttaattgtacttttggacccctatctttctaaaagttgcggttatggac |
14460564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 16490974 - 16491022
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
16490974 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttatg |
16491022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 20287767 - 20287815
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
20287767 |
ggcttaattgcacttttggaaccctacctttccaaaagttgcggttatg |
20287815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 22071166 - 22071214
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
22071166 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
22071214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 377 - 433
Target Start/End: Complemental strand, 32038161 - 32038105
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||| ||||||||||||| |||||||| ||||||| ||| |||||||| |||||| |
|
|
| T |
32038161 |
tttttttttggcttaattgcacttttggatccctatctttctaaaagttgtggttat |
32038105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 49227123 - 49227171
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
49227123 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
49227171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 2372725 - 2372674
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
2372725 |
ggcttaattgcaattttggacccctatctttttaaaagttgcggttatggac |
2372674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 2383346 - 2383397
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
2383346 |
ggcttaattgcaattttggacccctatctttttaaaagttgcggttatggac |
2383397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 3383964 - 3384011
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||| ||||| || |||||||||||||||| |
|
|
| T |
3383964 |
ggcttaattgcacttttggacctctatcttttcaaaagttgcggttat |
3384011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 398 - 437
Target Start/End: Complemental strand, 23208607 - 23208568
Alignment:
| Q |
398 |
cttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
23208607 |
cttttggacccctatctttccaaaagttgcggttacggac |
23208568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 388 - 435
Target Start/End: Complemental strand, 30289458 - 30289411
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||| ||||||||||| |||| ||||||||||| ||||||||| |
|
|
| T |
30289458 |
cttaattgcacttttggacccatatctttccaaaagttacggttatgg |
30289411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 433
Target Start/End: Complemental strand, 30295183 - 30295136
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||||||| |||||| |
|
|
| T |
30295183 |
ggcttaattgcacttttggacccctatctttctaaaagttgtggttat |
30295136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 38622403 - 38622454
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || || ||||||| ||||||||| |
|
|
| T |
38622403 |
ggcttaattgcacttttggacccctatcttttcagaagttgcagttatggac |
38622454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 435
Target Start/End: Original strand, 42589418 - 42589469
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| ||||||||| ||||| || |||||||||||||||||| |
|
|
| T |
42589418 |
ttggcttaattgcacttttggacttctatctttacaaaagttgcggttatgg |
42589469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 51272991 - 51272940
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| ||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
51272991 |
ggcttaattgcacttttagacccttatctttcaaaaagttgcggttatggac |
51272940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 4243440 - 4243390
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
4243440 |
ggcttaattgcacttttggatccctatctttttaaaagttgcggttatgga |
4243390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 16491288 - 16491238
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||| |||| || ||||||||||||||||||| |
|
|
| T |
16491288 |
ggcttaattgcacttttggacctttatcttttcaaaagttgcggttatgga |
16491238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 381 - 435
Target Start/End: Complemental strand, 18590148 - 18590094
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||| || |||||||| |||||||| |
|
|
| T |
18590148 |
ttattggcttaattgcacttttggatccctatctttttaaaagttgtggttatgg |
18590094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 428
Target Start/End: Original strand, 35580738 - 35580780
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcg |
428 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
35580738 |
ggcttaattgcacttttggccccctatctttccaaaagttgcg |
35580780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 437
Target Start/End: Complemental strand, 41585597 - 41585547
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||| ||||| || ||||||||||||||||||| |
|
|
| T |
41585597 |
gcttaattgcacttttggacctctatctttttaaaagttgcggttatggac |
41585547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 43677416 - 43677367
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||||| |||||||| ||||||| || ||||||||||||||||| |
|
|
| T |
43677416 |
ttggcttaattgcacttttgga-ccctatcttttcaaaagttgcggttatg |
43677367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 434
Target Start/End: Complemental strand, 52363490 - 52363444
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||| |||| |||||||||| |||||||||||||||||||| |
|
|
| T |
52363490 |
cttaattgcattttttgacccctatctttccaaaagttgcggttatg |
52363444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 381 - 434
Target Start/End: Original strand, 921748 - 921801
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||| ||||||||| | |||||| ||| ||||| |||||||||||||||||||| |
|
|
| T |
921748 |
ttataggcttaattacacttttgaacctctatctttccaaaagttgcggttatg |
921801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 377 - 426
Target Start/End: Original strand, 7489500 - 7489549
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttg |
426 |
Q |
| |
|
|||||| ||| ||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
7489500 |
tttttttttgacttaattgcacttttggccccctatctttccaaaagttg |
7489549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 19830116 - 19830165
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| ||||||||||| |||| ||| ||||||||||| ||||||| |
|
|
| T |
19830116 |
cttaattgcacttttggacccttatctttcaaaaagttgcggctatggac |
19830165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 389 - 434
Target Start/End: Original strand, 26434712 - 26434757
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||| |||||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
26434712 |
ttaattgcacttttgaacccctatctttccaaaagttacggttatg |
26434757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 29704619 - 29704664
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||| |||||||||| ||||| || |||||||||||||||| |
|
|
| T |
29704619 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttat |
29704664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 424
Target Start/End: Complemental strand, 866459 - 866419
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagt |
424 |
Q |
| |
|
||||||||||||| |||||||| ||||||| |||||||||| |
|
|
| T |
866459 |
ttggcttaattgcacttttggatccctatctttccaaaagt |
866419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 6809379 - 6809331
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
6809379 |
ttaattgcatttttggacccctatcttttcaaaagttgtggttatggac |
6809331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 9332906 - 9332954
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||| | ||||| || |||||||||||||||||||| |
|
|
| T |
9332906 |
ttaattgcacttttggagctctatcttttcaaaagttgcggttatggac |
9332954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 9356679 - 9356727
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||| | ||||| || |||||||||||||||||||| |
|
|
| T |
9356679 |
ttaattgcacttttggagctctatcttttcaaaagttgcggttatggac |
9356727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 398 - 434
Target Start/End: Original strand, 34988102 - 34988138
Alignment:
| Q |
398 |
cttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |
|
|
| T |
34988102 |
cttttggacccctatcttttcaaaagttgcggttatg |
34988138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 381 - 437
Target Start/End: Original strand, 51272672 - 51272728
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||||| |||||| ||| ||||| || | |||||||||||||||||| |
|
|
| T |
51272672 |
ttattggcttaattgtacttttgaacctctatcttttcgaaagttgcggttatggac |
51272728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 376 - 436
Target Start/End: Original strand, 400694 - 400754
Alignment:
| Q |
376 |
cttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
400694 |
cttttttataggcttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
400754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 401019 - 400968
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
401019 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
400968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 7e-19; HSPs: 111)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 381 - 437
Target Start/End: Original strand, 1466805 - 1466861
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1466805 |
ttattggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
1466861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 381 - 435
Target Start/End: Original strand, 17798843 - 17798897
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17798843 |
ttattggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
17798897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 372 - 437
Target Start/End: Original strand, 1375032 - 1375097
Alignment:
| Q |
372 |
ggttcttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| |||| ||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
1375032 |
ggttgttttgtattggcttaattgcacttttggacccctatctttccaaaagttacggttatggac |
1375097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 380 - 437
Target Start/End: Complemental strand, 36987732 - 36987675
Alignment:
| Q |
380 |
tttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36987732 |
tttaatggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
36987675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 19256902 - 19256851
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19256902 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
19256851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 377 - 435
Target Start/End: Complemental strand, 34850979 - 34850921
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
34850979 |
tttttttttggcttaattgcacttttggacccctatctttccaaaagttgcagttatgg |
34850921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 41071822 - 41071880
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||| |||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
41071822 |
ttttataggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggac |
41071880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 22194763 - 22194710
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
22194763 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
22194710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 23000822 - 23000773
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23000822 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
23000773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 376 - 437
Target Start/End: Complemental strand, 24895234 - 24895173
Alignment:
| Q |
376 |
cttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| | ||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
24895234 |
cttttttttaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
24895173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 25429922 - 25429971
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25429922 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
25429971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 36987410 - 36987463
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
36987410 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcgtttatggac |
36987463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 39642727 - 39642780
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
39642727 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
39642780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 35699162 - 35699114
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35699162 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
35699114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 42445375 - 42445423
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42445375 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
42445423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 378 - 437
Target Start/End: Original strand, 1374790 - 1374849
Alignment:
| Q |
378 |
tttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| || |||||||| ||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
1374790 |
tttttataggtttaattgcacttttagacccctatctttccaaaagttgcggttatggac |
1374849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 382 - 437
Target Start/End: Original strand, 21552537 - 21552592
Alignment:
| Q |
382 |
tattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
21552537 |
tattggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
21552592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 24205294 - 24205345
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
24205294 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
24205345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 25887894 - 25887945
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
25887894 |
ggcttaattgcacttttggacccttatctttccaaaagttgcggttatggac |
25887945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 31784252 - 31784303
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
31784252 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
31784303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 40493958 - 40493907
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
40493958 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
40493907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 41072141 - 41072090
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41072141 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
41072090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 45127149 - 45127098
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
45127149 |
ggcttaattgcacttttggacccctatctttccaaaagttgcagttatggac |
45127098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 389 - 435
Target Start/End: Original strand, 315021 - 315067
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
315021 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
315067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 437
Target Start/End: Original strand, 8519263 - 8519317
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| |||||||| |||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
8519263 |
attggtttaattgcacttttgaacccctatctttccaaaagttgcggttatggac |
8519317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 389 - 435
Target Start/End: Complemental strand, 17799139 - 17799093
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17799139 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
17799093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 21843495 - 21843445
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||||| ||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
21843495 |
ttggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
21843445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 1375397 - 1375348
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1375397 |
cttaattgaacttttggacccctatctttccaaaagttgcggttatggac |
1375348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 1375472 - 1375423
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
1375472 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
1375423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 3263035 - 3263084
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
3263035 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatgg |
3263084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 9715162 - 9715113
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
9715162 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggtcatgg |
9715113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 382 - 435
Target Start/End: Complemental strand, 19473332 - 19473279
Alignment:
| Q |
382 |
tattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||| |||||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
19473332 |
tattggtttaattgcacttttggacccttatctttccaaaagttgcggttatgg |
19473279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 21552856 - 21552803
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| ||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
21552856 |
ttggcttaattgcacttttggacccatatcttttcaaaagttgcggttatggac |
21552803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 25430083 - 25430034
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
25430083 |
ggcttaattgcacttttggacccctatctttccaaaagttgcagttatgg |
25430034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 26717454 - 26717405
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
26717454 |
ggcttaattgcacttttggacccatatctttccaaaagttgcggttatgg |
26717405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 11362564 - 11362612
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
11362564 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
11362612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 24857886 - 24857934
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
24857886 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
24857934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 30219019 - 30218971
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
30219019 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
30218971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 36566764 - 36566716
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| ||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
36566764 |
ggcttaattgcacttctggacccctatctttccaaaagttgcggttatg |
36566716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 38731278 - 38731326
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
38731278 |
tggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
38731326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 437
Target Start/End: Original strand, 40493645 - 40493697
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
40493645 |
tggcttaattgcacttttggacccctatctttttaaaagttgcggttatggac |
40493697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 387 - 435
Target Start/End: Original strand, 40506204 - 40506252
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||| |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
40506204 |
gcttaattgcacttttggaccccaatctttccaaaagttgcggttatgg |
40506252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 41829468 - 41829520
Alignment:
| Q |
386 |
ggcttaattgctctttt-ggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41829468 |
ggcttaattgcactttttggacccctatctttccaaaagttgcggttatggac |
41829520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 1467121 - 1467070
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
1467121 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
1467070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 2936789 - 2936840
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
2936789 |
ggcttaattgcacttttggacccttatcttttcaaaagttgcggttatggac |
2936840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 7464252 - 7464201
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
7464252 |
ggcttaattgcacttttggactcctatctttccaaaagttacggttatggac |
7464201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 7537413 - 7537464
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
7537413 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggttacggac |
7537464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 11367113 - 11367062
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||| ||||||| |
|
|
| T |
11367113 |
ggcttaattgcacttttggacccttatctttccaaaagttgcggctatggac |
11367062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 13732480 - 13732429
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
13732480 |
ggcttaattgcacttttggatccctatctttctaaaagttgcggttatggac |
13732429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 384 - 435
Target Start/End: Original strand, 19473074 - 19473125
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
19473074 |
ttggcttaattgcatttttggacccctatctttctaaaagttgcggttatgg |
19473125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 20436058 - 20436109
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
20436058 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggac |
20436109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 22093235 - 22093286
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| ||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
22093235 |
ggcttaaatgcacttttggacccctatcttttcaaaagttgcggttatggac |
22093286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 22093531 - 22093480
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
22093531 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
22093480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 25888204 - 25888153
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
25888204 |
ggcttaattgcacttttggacccctatctttacaaaagttacggttatggac |
25888153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 33004709 - 33004760
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
33004709 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggac |
33004760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 39245978 - 39245927
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
39245978 |
ggcttaattgcacttttggacccatatctttccaaaagttgcgattatggac |
39245927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 39620545 - 39620596
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
39620545 |
ggcttaattgcacttttgggtccctatctttccaaaagttgcggttatggac |
39620596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 42445685 - 42445634
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
42445685 |
ggcttaattgcacttttggatccctatctttctaaaagttgcggttatggac |
42445634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 437
Target Start/End: Complemental strand, 15977521 - 15977471
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
15977521 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
15977471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 399 - 437
Target Start/End: Complemental strand, 40324930 - 40324892
Alignment:
| Q |
399 |
ttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40324930 |
ttttggacccctatctttccaaaagttgcggttatggac |
40324892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 437
Target Start/End: Original strand, 45126840 - 45126890
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45126840 |
gcttaattgcacttttggacccctatatatccaaaagttgcggttatggac |
45126890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 388 - 434
Target Start/End: Original strand, 45395233 - 45395279
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
45395233 |
cttaattgcacttttggacccctacctttccaaaagttgcggttatg |
45395279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 315316 - 315267
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||| ||||||||||||||||| |
|
|
| T |
315316 |
ggcttaattgcacttttggacccatatctttctaaaagttgcggttatgg |
315267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 3263329 - 3263280
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||| |||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
3263329 |
ggcttacttgcacttttggacccctatctttctaaaagttgcggttatgg |
3263280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 389 - 434
Target Start/End: Complemental strand, 8739139 - 8739094
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
8739139 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
8739094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 22699454 - 22699507
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
22699454 |
ttggcttaattgtacttttggacccctatcttttcaaaagttgtggttatggac |
22699507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 377 - 434
Target Start/End: Complemental strand, 24858198 - 24858141
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||| | ||||||||||| |||||||| ||||||| || ||||||||||||||||| |
|
|
| T |
24858198 |
ttttttttaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatg |
24858141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 387 - 436
Target Start/End: Original strand, 24894970 - 24895019
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||||| |||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
24894970 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatgga |
24895019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 36589731 - 36589780
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
36589731 |
ggcttaattgcacttttggacccttatcttttcaaaagttgcggttatgg |
36589780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 36590025 - 36589976
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
36590025 |
ggcttaattgcacttttggacccttatcttttcaaaagttgcggttatgg |
36589976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 11366798 - 11366850
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccc-tatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| | |||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
11366798 |
ggcttaattacacttttggaccccctatctttccaaaagttgcggttatggac |
11366850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 379 - 427
Target Start/End: Original strand, 16865312 - 16865360
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgc |
427 |
Q |
| |
|
|||| ||||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
16865312 |
tttttttggcttaattgcacttttggccccctatctttccaaaagttgc |
16865360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 432
Target Start/End: Complemental strand, 17102624 - 17102576
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||||| |||||| ||||||| | |||||||||||||||||| |
|
|
| T |
17102624 |
ttggcttaattgcacttttgaacccctaactttccaaaagttgcggtta |
17102576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 19025824 - 19025872
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| ||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
19025824 |
ggcttaattgcactttttgacccctatcttttcaaaagttgcggttatg |
19025872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 19368806 - 19368758
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||||||||||| |
|
|
| T |
19368806 |
ggcttaattgcacttttggacccttatcttttcaaaagttgcggttatg |
19368758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 437
Target Start/End: Original strand, 20494338 - 20494390
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| |||||||||||||||| || |||||||| |||||||||| |
|
|
| T |
20494338 |
tggcttaattgcacttttggacccctatctttttaaaagttgtggttatggac |
20494390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 33005006 - 33004954
Alignment:
| Q |
386 |
ggcttaattgctcttttgga-cccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
33005006 |
ggcttaattgcacttttggatcccctatcttttcaaaagttgcggttatggac |
33004954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 34123245 - 34123292
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
34123245 |
ttaattgcacttttggaccc-tatctttccaaaagttgcggttatggac |
34123292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 40445573 - 40445621
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
40445573 |
ggcttaattgcacttttggacccatatctttccaaacgttgcggttatg |
40445621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 41829775 - 41829727
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
41829775 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggac |
41829727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 2382870 - 2382819
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2382870 |
ggcttaattgcacttttaaacccctatatttccaaaagttgcggttatggac |
2382819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 428
Target Start/End: Original strand, 10857338 - 10857381
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcg |
428 |
Q |
| |
|
|||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
10857338 |
tggcttaattgcacttttggccccctatctttccaaaagttgcg |
10857381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 398 - 437
Target Start/End: Complemental strand, 11362862 - 11362823
Alignment:
| Q |
398 |
cttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
11362862 |
cttttggacccctatcatttcaaaagttgcggttatggac |
11362823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 13485486 - 13485435
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
13485486 |
ggcttaattgcacttttatacccctatcttttcaaaagttgcggttatggac |
13485435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 22136893 - 22136944
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| ||||||||||| | ||||||||| |
|
|
| T |
22136893 |
ggcttaattgcacttttagacccctatctttccaaaagttacagttatggac |
22136944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 22194448 - 22194499
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| | ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
22194448 |
ggcttaatttcatttttggacccctatcttttcaaaagttgcggttatggac |
22194499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 398 - 437
Target Start/End: Complemental strand, 24205597 - 24205558
Alignment:
| Q |
398 |
cttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
24205597 |
cttttggacccctatcttttcaaaagttgcggttatggac |
24205558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 31784564 - 31784513
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
31784564 |
ggcttaattgcatttttggatccctatcttttcaaaagttgcggttatggac |
31784513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 428
Target Start/End: Complemental strand, 32661749 - 32661706
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcg |
428 |
Q |
| |
|
|||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
32661749 |
tggcttaattgcacttttggccccctatctttccaaaagttgcg |
32661706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 388 - 435
Target Start/End: Original strand, 36566605 - 36566652
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||| ||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
36566605 |
cttaattgcacttctggacccctatcttttcaaaagttgcggttatgg |
36566652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 40324634 - 40324685
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| || ||||||||||| |||||||| |
|
|
| T |
40324634 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcgattatggac |
40324685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 40711336 - 40711387
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
40711336 |
ggcttaattgtatttttggacccctatcttttcaaaagttgcggttatggac |
40711387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 45395551 - 45395500
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||| |||| |||||||||||||| |
|
|
| T |
45395551 |
ggcttaattgcacttttggatccctatctttctaaaaattgcggttatggac |
45395500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 383 - 437
Target Start/End: Original strand, 13123419 - 13123473
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||| |||||||||||||||| || |||||||| |||||||||| |
|
|
| T |
13123419 |
attgacttaattgcacttttggacccctatctttttaaaagttgaggttatggac |
13123473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 432
Target Start/End: Original strand, 17096911 - 17096957
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||| |||||||| ||||| | |||||||||||||||||| |
|
|
| T |
17096911 |
ggcttaattgcacttttggatccctaactttccaaaagttgcggtta |
17096957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 437
Target Start/End: Complemental strand, 21568237 - 21568187
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| ||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
21568237 |
gcttaattgcatttttggatccctatcttttcaaaagttgcggttatggac |
21568187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 389 - 435
Target Start/End: Original strand, 23000530 - 23000576
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
23000530 |
ttaattgcacttttggacccttatttttccaaaagttgcggttatgg |
23000576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 424
Target Start/End: Original strand, 26717158 - 26717196
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagt |
424 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
26717158 |
ggcttaattgcacttttggacccctatctttccaaaagt |
26717196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 428
Target Start/End: Original strand, 34600547 - 34600589
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcg |
428 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
34600547 |
ggcttaattgcacttttggccccctatctttccaaaagttgcg |
34600589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 389 - 435
Target Start/End: Original strand, 34850680 - 34850726
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
34850680 |
ttaattgcacttttggacccttatttttccaaaagttgcggttatgg |
34850726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 428
Target Start/End: Complemental strand, 36286467 - 36286425
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcg |
428 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
36286467 |
ggcttaattgcacttttggccccctatctttccaaaagttgcg |
36286425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 383 - 437
Target Start/End: Complemental strand, 39431485 - 39431431
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||| || ||||||||||||||||||| |
|
|
| T |
39431485 |
attggcttaattgcacttttgaacctctatctttttaaaagttgcggttatggac |
39431431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 432
Target Start/End: Complemental strand, 40445866 - 40445820
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||||||| ||||| |
|
|
| T |
40445866 |
ggcttaattgcacttttggacccctatctttctaaaagttgtggtta |
40445820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 9484703 - 9484752
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| ||||| ||| ||||| ||||||||||||||||||||||| |
|
|
| T |
9484703 |
cttaattgcacttttaaacctctatctttccaaaagttgcggttatggac |
9484752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 9714868 - 9714917
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||| || |||||| ||||||||||||||| ||||| |
|
|
| T |
9714868 |
ggcttaattgcacttttgaactcctatctttccaaaagttgcggctatgg |
9714917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 431
Target Start/End: Complemental strand, 10741391 - 10741346
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtt |
431 |
Q |
| |
|
||||||||||| ||||||| |||||||| || |||||||||||||| |
|
|
| T |
10741391 |
ggcttaattgcacttttggccccctatcttttcaaaagttgcggtt |
10741346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 389 - 434
Target Start/End: Complemental strand, 24365180 - 24365135
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||| ||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
24365180 |
ttaattgcatttttggacctctatctttccaaaagttgcggttatg |
24365135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 383 - 428
Target Start/End: Complemental strand, 35180601 - 35180557
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcg |
428 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
35180601 |
attggcttaattgcacttttgg-cccctatctttccaaaagttgcg |
35180557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 433
Target Start/End: Complemental strand, 19026127 - 19026083
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||||| |||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
19026127 |
ttaattgcacttttgaatccctatctttccaaaagttgcggttat |
19026083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 34981692 - 34981644
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
34981692 |
ttaattgcatttttagacccctatcttttcaaaagttgcggttatggac |
34981644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 39431172 - 39431220
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
39431172 |
ttaattgcacttttgaacttctatctttccaaaagttgcggttatggac |
39431220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 1e-17; HSPs: 144)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 39976722 - 39976780
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39976722 |
tttttttggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
39976780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 4061310 - 4061250
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4061310 |
tttttttttggcttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
4061250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 7974713 - 7974653
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7974713 |
ttttttctaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
7974653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 381 - 437
Target Start/End: Original strand, 18295847 - 18295903
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18295847 |
ttattggtttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
18295903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 3235429 - 3235378
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3235429 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
3235378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 5096788 - 5096839
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5096788 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
5096839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 11900050 - 11900101
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11900050 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
11900101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 11900363 - 11900312
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11900363 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
11900312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 16879551 - 16879500
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16879551 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
16879500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 384 - 435
Target Start/End: Complemental strand, 19233634 - 19233583
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19233634 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
19233583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 21782603 - 21782654
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21782603 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
21782654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 25982989 - 25983040
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25982989 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
25983040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 27432490 - 27432541
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27432490 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
27432541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 35437527 - 35437476
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35437527 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
35437476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 36376060 - 36376111
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36376060 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
36376111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 39753872 - 39753923
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39753872 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
39753923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 42997056 - 42997107
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42997056 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
42997107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 46622554 - 46622605
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46622554 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
46622605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 436
Target Start/End: Complemental strand, 388217 - 388164
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
388217 |
attggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
388164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 10319208 - 10319155
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
10319208 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
10319155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 30699339 - 30699286
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
30699339 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
30699286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 35923894 - 35923943
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35923894 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
35923943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 38445721 - 38445668
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
38445721 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
38445668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 227948 - 228008
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
227948 |
tttttttttggtttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
228008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 437
Target Start/End: Original strand, 18073815 - 18073867
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| ||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
18073815 |
tggcttaattgcacttttagacccctatctttccaaaagttgcggttatggac |
18073867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 24775947 - 24775887
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
24775947 |
tttttttttggcttaattgcacttttggacccctatctctccaaaagttgtggttatggac |
24775887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 25986916 - 25986976
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
25986916 |
ttttttttaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
25986976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 25987233 - 25987185
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25987233 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
25987185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 27512793 - 27512853
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
27512793 |
ttttttaaaggcttaattgcacttttggacccctatctttacaaaagttgcggttatggac |
27512853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 34288048 - 34288096
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34288048 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
34288096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 37452371 - 37452311
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| || ||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
37452371 |
tttttaataggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
37452311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 387 - 435
Target Start/End: Original strand, 44189406 - 44189454
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44189406 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
44189454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 48871398 - 48871350
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48871398 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
48871350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 931021 - 930970
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
931021 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
930970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 3925793 - 3925844
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
3925793 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
3925844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 3926071 - 3926020
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3926071 |
ggcttaattgcacttttggacccctatatttccaaaagttgcggttatggac |
3926020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 9629329 - 9629278
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9629329 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
9629278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 10312540 - 10312489
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
10312540 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatggac |
10312489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 377 - 432
Target Start/End: Original strand, 10715829 - 10715884
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
10715829 |
tttttttttggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
10715884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 382 - 437
Target Start/End: Original strand, 16537073 - 16537128
Alignment:
| Q |
382 |
tattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||||| ||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
16537073 |
tattggcttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
16537128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 382 - 437
Target Start/End: Complemental strand, 16628589 - 16628534
Alignment:
| Q |
382 |
tattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||||| ||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
16628589 |
tattggcttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
16628534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 18296164 - 18296113
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
18296164 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatggac |
18296113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 18852495 - 18852546
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
18852495 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
18852546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 18852806 - 18852755
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
18852806 |
ggcttaattgcacttttggacccctatctttccaaaagttgaggttatggac |
18852755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 19194160 - 19194207
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19194160 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
19194207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 19194474 - 19194423
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
19194474 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
19194423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 21917563 - 21917512
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
21917563 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
21917512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 23909895 - 23909946
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
23909895 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
23909946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 26612342 - 26612393
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
26612342 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatggac |
26612393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 26612656 - 26612605
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
26612656 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
26612605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 30140920 - 30140971
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30140920 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
30140971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 32555614 - 32555563
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
32555614 |
ggcttaattgcacttttggacccctatctttcaaaaagttgcggttatggac |
32555563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 34533526 - 34533475
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
34533526 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
34533475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 35121726 - 35121675
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
35121726 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
35121675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 35437206 - 35437257
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| | |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35437206 |
ggcttaattgcacatttggacccctatctttccaaaagttgcggttatggac |
35437257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 35924204 - 35924153
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
35924204 |
ggcttaattgcacttttggacccctatctttccaaaagttgcagttatggac |
35924153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 389 - 436
Target Start/End: Complemental strand, 36376372 - 36376325
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36376372 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
36376325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 378 - 437
Target Start/End: Complemental strand, 37047987 - 37047928
Alignment:
| Q |
378 |
tttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| ||| ||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
37047987 |
ttttttttgacttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
37047928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 44214659 - 44214710
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
44214659 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
44214710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 5097105 - 5097047
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||| |||||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
5097105 |
ttttatttgcttaattgcacttttgaacccctatctttccaaaagttgtggttatggac |
5097047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 10385764 - 10385714
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
10385764 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcgattatg |
10385714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 18074128 - 18074078
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| ||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
18074128 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgga |
18074078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 18363607 - 18363557
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
18363607 |
ggcttaattgcacttttggacccctatctttgcaaaagttgcggttatgga |
18363557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 437
Target Start/End: Original strand, 34404440 - 34404494
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||| ||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
34404440 |
attggcttaattgcacttttagacccctatctttccaaaaattgcggttatggac |
34404494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 37996010 - 37996068
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
37996010 |
ttttataggcttaattgcacttttggacccctatcttttcaaacgttgcggttatggac |
37996068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 38879463 - 38879413
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
38879463 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggctatgga |
38879413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 10356411 - 10356362
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10356411 |
ggcttaattgcacttttggacccctatatttccaaaagttgcggttatgg |
10356362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 19233340 - 19233389
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
19233340 |
ggcttaattgcacttttggaaccctatctttccaaaagttgcggttatgg |
19233389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 23910170 - 23910117
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
23910170 |
ttggcttaattgcacttttggaccactatcttttcaaaagttgcggttatggac |
23910117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 35711973 - 35711920
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| |||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
35711973 |
ttggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
35711920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 38053463 - 38053410
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| ||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
38053463 |
ttggcttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
38053410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 43408517 - 43408468
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
43408517 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
43408468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 43632341 - 43632390
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
43632341 |
ggcttaattgcacttttggacccctatctttccaaaaattgcggttatgg |
43632390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 437
Target Start/End: Original strand, 930707 - 930759
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| | |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
930707 |
tggcttaattacacttttggacccctatcttttcaaaagttgcggttatggac |
930759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 379 - 435
Target Start/End: Complemental strand, 11275485 - 11275429
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||||||||| | | |||||||||||||| || |||||||||||||||||| |
|
|
| T |
11275485 |
ttttattggcttaattacacctttggacccctatcttttcaaaagttgcggttatgg |
11275429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 19778567 - 19778519
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
19778567 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
19778519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 378 - 437
Target Start/End: Complemental strand, 23740587 - 23740527
Alignment:
| Q |
378 |
tttttatt-ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
23740587 |
tttttattaggcttaattgtacttttggacccctatctttcgaaaagttgcggttatggac |
23740527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 381 - 433
Target Start/End: Complemental strand, 30141238 - 30141186
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
30141238 |
ttataggcttaattgcacttttggacccctatctttgcaaaagttgcggttat |
30141186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 34533214 - 34533262
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
34533214 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatg |
34533262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 38882687 - 38882635
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatc-gttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38882687 |
ggcttaattgcacttttggacccctatcttttccaaaagttgcggttatggac |
38882635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 40436036 - 40436084
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
40436036 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
40436084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 45231830 - 45231782
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
45231830 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggac |
45231782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 7974389 - 7974440
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
7974389 |
ggcttaattgcacttttgaacccctatttttccaaaagttgcggttatggac |
7974440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 16879235 - 16879286
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
16879235 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
16879286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 18363295 - 18363346
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
18363295 |
ggcttaattgcacttttggacccctatgtttccaaaagttgcgattatggac |
18363346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 23740264 - 23740315
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
23740264 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
23740315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 27513114 - 27513063
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
27513114 |
ggcttaattgcacttttggacccctatcttttcgaaagttgcggttatggac |
27513063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 30699023 - 30699074
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||||||||||||| ||||||||| |
|
|
| T |
30699023 |
ggcttaattgcacttttggatccctatctttccaaaagttgcagttatggac |
30699074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 30757224 - 30757275
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
30757224 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggttatggac |
30757275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 35121413 - 35121464
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
35121413 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
35121464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 384 - 435
Target Start/End: Original strand, 43408222 - 43408273
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| | |||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
43408222 |
ttggcttaatttcacttttggacctctatctttccaaaagttgcggttatgg |
43408273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 436
Target Start/End: Original strand, 45231521 - 45231572
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||||||| |||||||||||||||| || |||||||| |||||||||| |
|
|
| T |
45231521 |
tggcttaattgcacttttggacccctatcttttcaaaagttacggttatgga |
45231572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 389 - 435
Target Start/End: Original strand, 11275190 - 11275236
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11275190 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatgg |
11275236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 11578369 - 11578319
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
11578369 |
ggcttaattgtacttttggacccctatctttccaaaggttgcggttatgga |
11578319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 389 - 435
Target Start/End: Original strand, 19778277 - 19778323
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
19778277 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
19778323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 432
Target Start/End: Original strand, 30085621 - 30085667
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
30085621 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
30085667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 432
Target Start/End: Complemental strand, 30086616 - 30086570
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
30086616 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
30086570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 383 - 437
Target Start/End: Complemental strand, 34288367 - 34288313
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| || ||||||||||||||||||| |
|
|
| T |
34288367 |
attggcttaattgcacttttgaacccctatctttttaaaagttgcggttatggac |
34288313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 399 - 437
Target Start/End: Complemental strand, 39754174 - 39754136
Alignment:
| Q |
399 |
ttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39754174 |
ttttggacccctatctttccaaaagttgcggttatggac |
39754136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 389 - 434
Target Start/End: Complemental strand, 3931804 - 3931759
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
3931804 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
3931759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 9035673 - 9035624
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
9035673 |
cttaattgcacttttggattcctatctttccaaaagttgcggttatggac |
9035624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 10351121 - 10351068
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||| ||| || |||||||| ||||||||||| |
|
|
| T |
10351121 |
ttggcttaattgcacttttggaccccaatcttttcaaaagttacggttatggac |
10351068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 389 - 434
Target Start/End: Original strand, 18798033 - 18798078
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
18798033 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
18798078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 20387555 - 20387604
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| ||||||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
20387555 |
cttaattgcacttttggacccttatctttccaaaagttgcagttatggac |
20387604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 20392029 - 20392078
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| ||||||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
20392029 |
cttaattgcacttttggacccttatctttccaaaagttgcagttatggac |
20392078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 30028396 - 30028445
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
30028396 |
cttaattgcactttaggacccctatctttctaaaagttgcggttatggac |
30028445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 47732014 - 47731965
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| ||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
47732014 |
cttaattgcacttttggacccttatcttttcaaaagttgcggttatggac |
47731965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 228268 - 228220
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||| ||||| |
|
|
| T |
228268 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttttggac |
228220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 10318891 - 10318939
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||| |||||| |
|
|
| T |
10318891 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcagttatg |
10318939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 11578058 - 11578106
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
11578058 |
ttaattgtacttttggacccctatcattcaaaaagttgcggttatggac |
11578106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 433
Target Start/End: Complemental strand, 18798320 - 18798276
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||||| |||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
18798320 |
ttaattgcacttttggatccctatctttccaaaagttgcggttat |
18798276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 37047668 - 37047716
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
37047668 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggac |
37047716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 42997366 - 42997318
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||||||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
42997366 |
tggcttaattgcatttttggacccctatcttttcaaaagttgcggttat |
42997318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 497112 - 497163
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| || |||||||||| ||||||||| |
|
|
| T |
497112 |
ggcttaattgcacttttggacccttatcttttcaaaagttgcagttatggac |
497163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 9035358 - 9035409
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
9035358 |
ggcttaattgcaattttggacccctatctttttaaaagttgcggttatggac |
9035409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 10350806 - 10350857
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
10350806 |
ggcttaattgcatttttggacccctatcttttcaaaagttgtggttatggac |
10350857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 435
Target Start/End: Original strand, 10385467 - 10385518
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| ||||| ||||| |||| ||| ||||||||||||||||| |
|
|
| T |
10385467 |
ttggcttaattgcacttttagacccttatctttctaaaagttgcggttatgg |
10385518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 16537390 - 16537339
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||| || ||| |||||||| |||||||||| |
|
|
| T |
16537390 |
ggcttaattgcacttttggacccctgtctttcgaaaagttgtggttatggac |
16537339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 16628272 - 16628323
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||| || ||| |||||||| |||||||||| |
|
|
| T |
16628272 |
ggcttaattgcacttttggacccctgtctttcgaaaagttgtggttatggac |
16628323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 17757770 - 17757821
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
17757770 |
ggcttaattgcacttttagacccctatctttttaaaagttgcggttatggac |
17757821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 20387863 - 20387812
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| |||||||||| |
|
|
| T |
20387863 |
ggcttaattgcacttttggacccatatcttttcaaaagttgtggttatggac |
20387812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 20392337 - 20392286
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| |||||||||| |
|
|
| T |
20392337 |
ggcttaattgcacttttggacccatatcttttcaaaagttgtggttatggac |
20392286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 21917086 - 21917137
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
21917086 |
ggcttaattgcacttttggatccctattttttcaaaagttgcggttatggac |
21917137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 425
Target Start/End: Complemental strand, 25683988 - 25683949
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagtt |
425 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
25683988 |
ggcttaattgcacttttggacccctatctttccaaaagtt |
25683949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 34404748 - 34404697
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| ||| |||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
34404748 |
ggcttaagtgcacttttgaacccttatctttccaaaagttgcggttatggac |
34404697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 35711659 - 35711709
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
35711659 |
ggcttaattgcacttttggacccctatcttttc-aaagttgcggttatggac |
35711709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 383 - 437
Target Start/End: Complemental strand, 37996328 - 37996273
Alignment:
| Q |
383 |
attggcttaattgctcttttgga-cccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| |||||||| ||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
37996328 |
attggtttaattgcatttttggatcccctatctttccaaaagttgcggttatggac |
37996273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 38053146 - 38053197
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| || |||||||||| |
|
|
| T |
38053146 |
ggcttaattgcacttttggacccctatctttccaaaaattttggttatggac |
38053197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 38879161 - 38879212
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
38879161 |
ggcttaattgtacttttggacctctatcttttcaaaagttgcggttatggac |
38879212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 46622866 - 46622815
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
46622866 |
ggcttaattgcacttttcaacccctatctttccaaaggttgcggttatggac |
46622815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 47731702 - 47731753
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||| |||||||||||||| |
|
|
| T |
47731702 |
ggcttaattgcacttttggacccctatcttttaaaaaattgcggttatggac |
47731753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 372 - 434
Target Start/End: Original strand, 3931632 - 3931694
Alignment:
| Q |
372 |
ggttcttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||| |||||| | ||||||||||| |||||||||| ||||| || ||||||||| ||||||| |
|
|
| T |
3931632 |
ggtttttttttttgggcttaattgcacttttggacctctatcttttcaaaagttggggttatg |
3931694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 434
Target Start/End: Original strand, 4060990 - 4061036
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||| |||||| ||||||||| || ||||||||||||||||| |
|
|
| T |
4060990 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
4061036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 21782915 - 21782865
Alignment:
| Q |
388 |
cttaattgctcttttggacccc-tatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
21782915 |
cttaattgcacttttggaccccctatctttccaaaagttgtggttatggac |
21782865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 26872675 - 26872625
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| | ||||||||||| |||| || ||||||||||||||||| |
|
|
| T |
26872675 |
ttggcttaattccacttttggacccttatcttttcaaaagttgcggttatg |
26872625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 389 - 435
Target Start/End: Complemental strand, 44189694 - 44189648
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| ||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
44189694 |
ttaattgcacttctggacccctatcttttcaaaagttgcggttatgg |
44189648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 400 - 437
Target Start/End: Original strand, 24236128 - 24236165
Alignment:
| Q |
400 |
tttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
24236128 |
tttggccccctatctttccaaaagttgcggttatggac |
24236165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 387 - 436
Target Start/End: Original strand, 25036033 - 25036082
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||||| ||||| ||||||||| || ||||||||||||||||||| |
|
|
| T |
25036033 |
gcttaattgcactttttgacccctatattttcaaaagttgcggttatgga |
25036082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 30401221 - 30401172
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||| |||||| || ||||||||| |||||||| |
|
|
| T |
30401221 |
ggcttaattgcacttttggactcctatcttttcaaaagttgtggttatgg |
30401172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 426
Target Start/End: Complemental strand, 31530433 - 31530392
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttg |
426 |
Q |
| |
|
|||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
31530433 |
tggcttaattgcacttttggccccctatctttccaaaagttg |
31530392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 11742973 - 11742929
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcg |
428 |
Q |
| |
|
||||||||||||| ||||||| |||||||| || ||||||||||| |
|
|
| T |
11742973 |
ttggcttaattgcacttttggccccctatcttttcaaaagttgcg |
11742929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 30757534 - 30757486
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
30757534 |
ttaattgcacttttggacccctatttttttaaaagttgcggttatggac |
30757486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 38882370 - 38882418
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| ||||| ||||||||| || ||||||||||||||||| |
|
|
| T |
38882370 |
ggcttaattgcatttttgtacccctatcttttcaaaagttgcggttatg |
38882418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 387 - 435
Target Start/End: Complemental strand, 40436288 - 40436240
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||| |||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
40436288 |
gcttaattgcatttttggacccttatctttccaaaagttgcgattatgg |
40436240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 1e-17; HSPs: 144)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 27264425 - 27264367
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27264425 |
ttttattggtttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
27264367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 28395253 - 28395195
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28395253 |
ttttattgacttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
28395195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 31172884 - 31172826
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31172884 |
ttttatttgcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
31172826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 41880357 - 41880299
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41880357 |
ttttatttgcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
41880299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 376 - 437
Target Start/End: Complemental strand, 26323698 - 26323637
Alignment:
| Q |
376 |
cttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
26323698 |
ctttttttttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
26323637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 437
Target Start/End: Complemental strand, 223208 - 223156
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
223208 |
tggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
223156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 30894116 - 30894176
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30894116 |
ttttttacaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
30894176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 2710340 - 2710391
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2710340 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
2710391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 4125444 - 4125495
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4125444 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
4125495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 5088385 - 5088334
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5088385 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
5088334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 15526704 - 15526755
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15526704 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
15526755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 16521154 - 16521205
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16521154 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
16521205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 16666886 - 16666835
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16666886 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
16666835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 27264109 - 27264160
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27264109 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
27264160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 28394933 - 28394984
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28394933 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
28394984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 29401402 - 29401351
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29401402 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
29401351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 40297665 - 40297716
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40297665 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
40297716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 40768201 - 40768150
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40768201 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
40768150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 437
Target Start/End: Original strand, 8339956 - 8340010
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
8339956 |
attggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
8340010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 3223597 - 3223548
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3223597 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
3223548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 377 - 434
Target Start/End: Original strand, 9071959 - 9072016
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9071959 |
ttttttttaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
9072016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 381 - 437
Target Start/End: Complemental strand, 13356868 - 13356811
Alignment:
| Q |
381 |
ttattggcttaattgctcttttgga-cccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
13356868 |
ttattggcttaattgcacttttggatcccctatctttccaaaagttgcggttatggac |
13356811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 20974462 - 20974511
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20974462 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
20974511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 21583638 - 21583585
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| ||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
21583638 |
ttggcttaattgcacttttggactcctatctttccaaaagttgcggttatggac |
21583585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 34169103 - 34169050
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
34169103 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
34169050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 43586099 - 43586050
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43586099 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
43586050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 4096443 - 4096503
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
4096443 |
ttttttattggtttaattgcacttttggacccctatctttctaaaagttgcgtttatggac |
4096503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 4125766 - 4125706
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
4125766 |
ttttttttaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggac |
4125706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 23263467 - 23263407
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| |||||||||| ||||| |||||| |||||||||||||||| |
|
|
| T |
23263467 |
tttttttttggcttaattgcacttttggacctctatctttccaacagttgcggttatggac |
23263407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 25566852 - 25566804
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25566852 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
25566804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 29183136 - 29183184
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29183136 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
29183184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 35306710 - 35306758
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35306710 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
35306758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 2710650 - 2710599
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
2710650 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
2710599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 3020907 - 3020856
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
3020907 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
3020856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 5088074 - 5088125
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
5088074 |
ggcttaattgcacttttggacccctatctttccaaaagttgcagttatggac |
5088125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 10029074 - 10029125
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| || ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10029074 |
ggcttaattacttttttggacccctatctttccaaaagttgcggttatggac |
10029125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 11480036 - 11480087
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
11480036 |
ggcttaattgcacttttggacccctatctttccaaaagttgaggttatggac |
11480087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 12049119 - 12049170
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
12049119 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
12049170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 13356557 - 13356608
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| ||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13356557 |
ggcttgattgcacttttggacccctatctttccaaaagttgcggttatggac |
13356608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 377 - 436
Target Start/End: Original strand, 15738065 - 15738124
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
15738065 |
tttttttttggcttaattgcactttttgacccctatcttttcaaaagttgcggttatgga |
15738124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 18266352 - 18266403
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
18266352 |
ggcttaattgcacttttggacccctatctttccaaaggttgcggttatggac |
18266403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 22052439 - 22052490
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
22052439 |
ggcttaattgcacttttggccccctatctttccaaaagttgcggttatggac |
22052490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 22052752 - 22052701
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22052752 |
ggcttaattgcaattttggacccctatctttccaaaagttgcggttatggac |
22052701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 23103923 - 23103974
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| | |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23103923 |
ggcttaattacacttttggacccctatctttccaaaagttgcggttatggac |
23103974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 23263145 - 23263196
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
23263145 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
23263196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 388 - 435
Target Start/End: Original strand, 28251400 - 28251447
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28251400 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
28251447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 28620039 - 28620090
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
28620039 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
28620090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 384 - 435
Target Start/End: Complemental strand, 28703964 - 28703913
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28703964 |
ttggctgaattgcacttttggacccctatctttccaaaagttgcggttatgg |
28703913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 34606683 - 34606632
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
34606683 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
34606632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 34734386 - 34734335
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
34734386 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
34734335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 35307015 - 35306964
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
35307015 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
35306964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 40687666 - 40687717
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
40687666 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
40687717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 391 - 437
Target Start/End: Original strand, 1050041 - 1050087
Alignment:
| Q |
391 |
aattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1050041 |
aattgcacttttggacccctatctttccaaaagttgcggttatggac |
1050087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 389 - 435
Target Start/End: Complemental strand, 5891790 - 5891744
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5891790 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
5891744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 372 - 437
Target Start/End: Original strand, 25631071 - 25631137
Alignment:
| Q |
372 |
ggttcttttttatt-ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
25631071 |
ggttattttttattaggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
25631137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 35055774 - 35055828
Alignment:
| Q |
384 |
ttggcttaattgctcttttgga-cccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
35055774 |
ttggcttaattgcacttttggatcccctatctttccaaaagttgcggttatggac |
35055828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 39529078 - 39529028
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||| | |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39529078 |
ggcttaattacacttttggacccctatctttccaaaagttgcggttatgga |
39529028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 9072262 - 9072213
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
9072262 |
ggcttaattgcacttttggacccttatctttccaaaagttgcggttatgg |
9072213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 16079491 - 16079442
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
16079491 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgg |
16079442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 23502443 - 23502390
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
23502443 |
ttggcttaattgcacttttggacccctatctttccaaaagttgctattatggac |
23502390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 26036529 - 26036480
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||| |||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26036529 |
ggctaaattgcacttttggacccctatctttccaaaagttgcggttatgg |
26036480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 28736438 - 28736491
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| |||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28736438 |
ttggtttaattgcacttttggacccctatttttccaaaagttgcggttatggac |
28736491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 381 - 434
Target Start/End: Complemental strand, 31456179 - 31456126
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
31456179 |
ttataggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
31456126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 32556058 - 32556009
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
32556058 |
ggcttaattgcacttttggacccatatctttccaaaagttgcggttatgg |
32556009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 40767890 - 40767939
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
40767890 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
40767939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 41032499 - 41032450
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
41032499 |
ggcttaattgcacttttggatccctatctttccaaaagttgcggttatgg |
41032450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 41140427 - 41140378
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
41140427 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatgg |
41140378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 1055374 - 1055422
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
1055374 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
1055422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 437
Target Start/End: Original strand, 8986609 - 8986661
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| ||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
8986609 |
tggcttaattgcacttttggactcctatctttccaaaagttacggttatggac |
8986661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 433
Target Start/End: Complemental strand, 12049439 - 12049383
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12049439 |
ttttttttaggcttaattgcatttttggacccctatctttccaaaagttgcggttat |
12049383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 13960691 - 13960739
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
13960691 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggac |
13960739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 14648010 - 14647950
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||| || ||||||| |||||||||||| |
|
|
| T |
14648010 |
tttttttttggcttaattgtacttttggacccctatcttttcaaaagtcgcggttatggac |
14647950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 19849555 - 19849603
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
19849555 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatggac |
19849603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 26151797 - 26151845
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
26151797 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
26151845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 433
Target Start/End: Complemental strand, 28251688 - 28251644
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28251688 |
ttaattgcacttttggacccctatctttccaaaagttgcggttat |
28251644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 21 - 109
Target Start/End: Complemental strand, 29233386 - 29233298
Alignment:
| Q |
21 |
aatggaaagaagccgtggggactttctttctcttttggaagagcacttcagcagagtactctcaaggcatgggctgggaaagatgaaaa |
109 |
Q |
| |
|
||||| |||||||| ||| ||||||||||||||||||| |||||||| |||||||| || ||||||||| |||| ||||| ||||| |
|
|
| T |
29233386 |
aatggtaagaagccatggactctttctttctcttttggaatggcacttcaacagagtacccttaaggcatggtctggaaaagaagaaaa |
29233298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 21 - 109
Target Start/End: Complemental strand, 29237136 - 29237048
Alignment:
| Q |
21 |
aatggaaagaagccgtggggactttctttctcttttggaagagcacttcagcagagtactctcaaggcatgggctgggaaagatgaaaa |
109 |
Q |
| |
|
||||| |||||||| ||| ||||| |||||||||||||| |||||||| |||||||| || ||||||||| |||| ||||| ||||| |
|
|
| T |
29237136 |
aatggtaagaagccatggaccctttccttctcttttggaagggcacttcaacagagtaccctaaaggcatggtctggaaaagaagaaaa |
29237048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 381 - 437
Target Start/End: Original strand, 29401085 - 29401141
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
29401085 |
ttattgacttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
29401141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 437
Target Start/End: Original strand, 31455881 - 31455933
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| ||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
31455881 |
tggcttaattgcacttttggacccttatcttttcaaaagttgcggttatggac |
31455933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 33825603 - 33825651
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| | |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33825603 |
ttaattgcacgtttggacccctatctttccaaaagttgcggttatggac |
33825651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 34082414 - 34082366
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
34082414 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
34082366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 34168790 - 34168838
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
34168790 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatggac |
34168838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 40297976 - 40297928
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
40297976 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatggac |
40297928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 433
Target Start/End: Complemental strand, 1055681 - 1055634
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
1055681 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttat |
1055634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 387 - 434
Target Start/End: Original strand, 2546372 - 2546419
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
2546372 |
gcttaattgcacttttggacccctatctttccaaaagttacggttatg |
2546419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 3020594 - 3020645
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
3020594 |
ggcttaattgcacttttggacccctattttttcaaaagttgcggttatggac |
3020645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 7219498 - 7219549
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
7219498 |
ggcttaattgcacttttggacccctattttttcaaaagttgcggttatggac |
7219549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 7219810 - 7219759
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
7219810 |
ggcttaattgcacttttggactcttatctttccaaaagttgcggttatggac |
7219759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 10029385 - 10029334
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
10029385 |
ggcttaattgcacttttgaacccctatctttcgaaaagttgcggttatggac |
10029334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 13170193 - 13170142
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
13170193 |
ggcttaattgcacttttggacccttatctttctaaaagttgcggttatggac |
13170142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 13765259 - 13765310
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
13765259 |
ggcttaattgcacttttcgacccctatcttttcaaaagttgcggttatggac |
13765310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 13765574 - 13765523
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
13765574 |
ggcttaattgcacttttggacccctatctttcaaaaaattgcggttatggac |
13765523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 14647696 - 14647747
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
14647696 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggttatggac |
14647747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 15738386 - 15738335
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
15738386 |
ggcttaattgcacttttggacccatatcttttcaaaagttgcggttatggac |
15738335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 16597353 - 16597302
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
16597353 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
16597302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 16666073 - 16666124
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
16666073 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
16666124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 19849856 - 19849805
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
19849856 |
ggcttaattgcacttttggacccctatatttccaaaagttgcggtcatggac |
19849805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 21583323 - 21583374
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
21583323 |
ggcttaattgcactttgggacctctatctttccaaaagttgcggttatggac |
21583374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 28736753 - 28736702
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
28736753 |
ggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggac |
28736702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 40687982 - 40687931
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
40687982 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggac |
40687931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 42947401 - 42947452
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
42947401 |
ggcttaattgcacttttggactcctatctttctaaaagttgcggttatggac |
42947452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 377 - 435
Target Start/End: Original strand, 3728275 - 3728333
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||| | |||||||||| |||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
3728275 |
ttttttgtaggcttaattgtacttttggacctctatctttccaaaagttgcggttatgg |
3728333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 437
Target Start/End: Complemental strand, 22773897 - 22773847
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
22773897 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttatggac |
22773847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 42739902 - 42739852
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
42739902 |
ttggcttaattgcacttttggacccctatctttttaaaagttgcggttatg |
42739852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 8755011 - 8755064
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| |||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
8755011 |
ttggtttaattgcacttttggacccctattttttcaaaagttgcggttatggac |
8755064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 20465503 - 20465552
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||| | |||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
20465503 |
ggcttaattacacttttggacccctatctttccaaaagttgcagttatgg |
20465552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 390 - 435
Target Start/End: Original strand, 43585809 - 43585854
Alignment:
| Q |
390 |
taattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
43585809 |
taattgcacttttggacccctatctttctaaaagttgcggttatgg |
43585854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 7623525 - 7623572
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
7623525 |
ttaattgcacttttggaccc-tatctttccaaaagttgcggttatggac |
7623572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 7623830 - 7623782
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
7623830 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
7623782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 9560147 - 9560099
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
9560147 |
ggcttaattgcatttttggacccctatctttctaaaagttgcggttatg |
9560099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 16597044 - 16597092
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
16597044 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggac |
16597092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 387 - 435
Target Start/End: Complemental strand, 16860118 - 16860070
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
16860118 |
gcttaattgcacttttggacccctatttttctaaaagttgcggttatgg |
16860070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 20974731 - 20974671
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | |||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
20974731 |
ttttttctaggcttaattgtacttttggacccctatcttttcaaaagttgtggttatggac |
20974671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 23104221 - 23104169
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgtt-ccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||||||||||||||| |
|
|
| T |
23104221 |
ggcttaattgcacttttggacccttatcttttccaaaagttgcggttatggac |
23104169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 34082102 - 34082150
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
34082102 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
34082150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 35678095 - 35678143
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
35678095 |
ttaattgcatttttggacccctatctttccaaaagttgcgattatggac |
35678143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 931847 - 931898
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
931847 |
ggcttaattgtacttttggatccctatcttttcaaaagttgcggttatggac |
931898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 4096764 - 4096713
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
4096764 |
ggcttaattgcacttttggacctttatcttttcaaaagttgcggttatggac |
4096713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 8340273 - 8340222
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| | |||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
8340273 |
ggcttaattccacttttggacccctatcttttcaaaagttgcgcttatggac |
8340222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 13961003 - 13960952
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
13961003 |
ggcttaattgtacttttggacctctatcttttcaaaagttgcggttatggac |
13960952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 22925699 - 22925746
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
22925699 |
ggcttaattgcacttttgaacctctatctttccaaaagttgcggttat |
22925746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 391 - 434
Target Start/End: Original strand, 23499971 - 23500014
Alignment:
| Q |
391 |
aattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
23499971 |
aattgcacttttggacccctatcttttcaaaagttgcggttatg |
23500014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 23695526 - 23695577
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| ||| |||| |||||||||||||||||| |
|
|
| T |
23695526 |
ggcttaattgcacttttggacccatatttttcccaaagttgcggttatggac |
23695577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 26152105 - 26152054
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| ||||| ||||| |||| ||||||||||||||||||||||| |
|
|
| T |
26152105 |
ggcttaattgtacttttagacccatatctttccaaaagttgcggttatggac |
26152054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 29391327 - 29391276
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| ||| | |||| ||||||||||||||||||||||| |
|
|
| T |
29391327 |
ggcttaattgcacttttagactcttatctttccaaaagttgcggttatggac |
29391276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 29559774 - 29559825
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
29559774 |
ggcttaattgcacttttggattcctatcttttcaaaagttgcggttatggac |
29559825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 435
Target Start/End: Original strand, 32555762 - 32555813
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
32555762 |
ttggcttaattgcatttttggacccctatctttttaaaagttgcggttatgg |
32555813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 39528766 - 39528817
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| ||||||||| || ||||||||||||||||||| |
|
|
| T |
39528766 |
ggcttaattgcacttttgaacccctatctttttaaaagttgcggttatggac |
39528817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 39284 - 39234
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||||| |||||||| ||||||| || |||||||||| |||||| |
|
|
| T |
39284 |
ttggcttaattgcacttttggatccctatcttttcaaaagttgcagttatg |
39234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 2546685 - 2546635
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||| ||||||||| || |||||||||| |||||||| |
|
|
| T |
2546685 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcagttatgga |
2546635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 389 - 435
Target Start/End: Complemental strand, 21347742 - 21347696
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
21347742 |
ttaattgcacttttggacccctatcttttcaaaagttacggttatgg |
21347696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 377 - 431
Target Start/End: Original strand, 34606364 - 34606418
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggtt |
431 |
Q |
| |
|
|||||| | ||||||||||| ||||| ||||||||| ||||||||||||||||| |
|
|
| T |
34606364 |
ttttttttaggcttaattgcacttttaaacccctatctttccaaaagttgcggtt |
34606418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 3223436 - 3223485
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
3223436 |
ggcttaattgcacttttggacccctatctattcaaaaattgcggttatgg |
3223485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 426
Target Start/End: Complemental strand, 4146452 - 4146411
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttg |
426 |
Q |
| |
|
|||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
4146452 |
tggcttaattgcacttttggccccctatctttccaaaagttg |
4146411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 383 - 428
Target Start/End: Original strand, 6815497 - 6815542
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcg |
428 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| || ||||||||||| |
|
|
| T |
6815497 |
attggcttaattgcacttttggccccctatcttttcaaaagttgcg |
6815542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 26036235 - 26036284
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||||| |||| || ||||||||| |||||||| |
|
|
| T |
26036235 |
ggcttaattgcacttttggacccatatcttttcaaaagttgtggttatgg |
26036284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 26323377 - 26323426
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| |||| |||| ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
26323377 |
cttatttgcactttgggacccctatctttccaaaagttggggttatggac |
26323426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 427
Target Start/End: Complemental strand, 37060211 - 37060170
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgc |
427 |
Q |
| |
|
||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
37060211 |
ggcttaattgcacttttggccccctatctttccaaaagttgc |
37060170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 431
Target Start/End: Complemental strand, 37333846 - 37333801
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtt |
431 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||| ||||||||||||| |
|
|
| T |
37333846 |
ggcttaattgcacttttggacccttatctttctaaaagttgcggtt |
37333801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 437
Target Start/End: Original strand, 42779165 - 42779218
Alignment:
| Q |
385 |
tggcttaattgctcttttgga-cccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| |||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
42779165 |
tggcttaattgcacttttggagcccctatctttttaaaagttgcggttatggac |
42779218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 387 - 435
Target Start/End: Complemental strand, 3728576 - 3728528
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||| |||||||| | ||||| ||||||||||| ||||||||| |
|
|
| T |
3728576 |
gcttaattgcacttttggatctctatctttccaaaagttacggttatgg |
3728528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 3738391 - 3738439
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
3738391 |
ttaattgcacttttggactcctattttttcaaaagttgcggttatggac |
3738439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 8755323 - 8755275
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
8755323 |
ttaattgcacttttggacccctattttttcaaaagttgtggttatggac |
8755275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 433
Target Start/End: Original strand, 33203941 - 33203985
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
33203941 |
ttaattgcaattttggacccctatcttttcaaaagttgcggttat |
33203985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 1e-17; HSPs: 158)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 17262405 - 17262347
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17262405 |
tttttttggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
17262347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 37289448 - 37289506
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37289448 |
ttttataggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
37289506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 376 - 437
Target Start/End: Complemental strand, 7666521 - 7666460
Alignment:
| Q |
376 |
cttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
7666521 |
ctttttttttggcttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
7666460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 437
Target Start/End: Complemental strand, 11159734 - 11159682
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11159734 |
tggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
11159682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 436
Target Start/End: Complemental strand, 27247174 - 27247122
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27247174 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
27247122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 381 - 437
Target Start/End: Complemental strand, 31844105 - 31844049
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31844105 |
ttattagcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
31844049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 42672390 - 42672330
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42672390 |
ttttttttaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
42672330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 104200 - 104251
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
104200 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
104251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 7705590 - 7705641
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7705590 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
7705641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 11529759 - 11529810
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11529759 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
11529810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 12641132 - 12641081
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12641132 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
12641081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 436
Target Start/End: Original strand, 21536879 - 21536930
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21536879 |
tggcttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
21536930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 23315691 - 23315640
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23315691 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
23315640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 24415387 - 24415336
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24415387 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
24415336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 27246859 - 27246910
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27246859 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
27246910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 41205498 - 41205549
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41205498 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
41205549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 41205809 - 41205758
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41205809 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
41205758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 384 - 435
Target Start/End: Original strand, 43821717 - 43821768
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43821717 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
43821768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 51537430 - 51537481
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51537430 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
51537481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 51696536 - 51696587
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51696536 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
51696587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 52045721 - 52045772
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52045721 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
52045772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 52310801 - 52310852
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52310801 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
52310852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 52311115 - 52311064
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52311115 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
52311064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 50996028 - 50996086
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
50996028 |
ttttattggcttaattgcacttttgaacccctatctttccaaaagttgtggttatggac |
50996086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 380 - 434
Target Start/End: Complemental strand, 51537935 - 51537881
Alignment:
| Q |
380 |
tttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51537935 |
tttattggcttaatttcacttttggacccctatctttccaaaagttgcggttatg |
51537881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 4902469 - 4902420
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4902469 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
4902420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 13021292 - 13021243
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13021292 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
13021243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 20472547 - 20472600
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| |||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20472547 |
ttggtttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
20472600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 379 - 436
Target Start/End: Original strand, 22159822 - 22159879
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
22159822 |
ttttatttgcttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
22159879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 48278231 - 48278178
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
48278231 |
ttggcttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
48278178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 7396141 - 7396189
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7396141 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
7396189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 7666200 - 7666248
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7666200 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
7666248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 14578438 - 14578486
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14578438 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
14578486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 17554048 - 17554096
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17554048 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
17554096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 27751474 - 27751426
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27751474 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
27751426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 34957667 - 34957619
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34957667 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
34957619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 51696851 - 51696791
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | |||||||| || |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51696851 |
ttttttttaggcttaatagcacttttggacccctatctttccaaaagttgcggttatggac |
51696791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 104513 - 104462
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
104513 |
ggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggac |
104462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 233004 - 232953
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
233004 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
232953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 1377605 - 1377656
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
1377605 |
ggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggac |
1377656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 5344584 - 5344533
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
5344584 |
ggcttaattgcacttttggacccttatctttccaaaagttgcggttatggac |
5344533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 6386731 - 6386782
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
6386731 |
ggcttaattgcacttttggacccctatctttccaaaagttgcagttatggac |
6386782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 7644457 - 7644508
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
7644457 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
7644508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 7705902 - 7705851
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
7705902 |
ggcttaattgcacttttggatccctatctttccaaaagttgcggttatggac |
7705851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 11530073 - 11530022
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
11530073 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
11530022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 12640820 - 12640871
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
12640820 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
12640871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 380 - 435
Target Start/End: Original strand, 13019267 - 13019322
Alignment:
| Q |
380 |
tttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || ||||||||| |||||||| |
|
|
| T |
13019267 |
tttattggcttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
13019322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 13607917 - 13607968
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13607917 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
13607968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 18988179 - 18988230
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
18988179 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
18988230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 20472859 - 20472808
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20472859 |
ggcttaattgtacttttggacccctatctttccaaaagttgcggttatggac |
20472808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 20474024 - 20473973
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
20474024 |
ggcttaattgcacttttagacccctatctttccaaaagttgcggttatggac |
20473973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 22160141 - 22160090
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
22160141 |
ggcttaattgcacttttagacccctatctttccaaaagttgcggttatggac |
22160090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 26675053 - 26675104
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26675053 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
26675104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 29548493 - 29548442
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
29548493 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
29548442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 389 - 436
Target Start/End: Complemental strand, 30998494 - 30998447
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30998494 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
30998447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 31250782 - 31250731
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
31250782 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
31250731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 34362820 - 34362871
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
34362820 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
34362871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 384 - 435
Target Start/End: Complemental strand, 34363133 - 34363082
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
34363133 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
34363082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 35364508 - 35364457
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
35364508 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatggac |
35364457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 39136298 - 39136349
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
39136298 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
39136349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 39136610 - 39136559
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
39136610 |
ggcttaattgcacttttggacccctatctttccaaaagtagcggttatggac |
39136559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 45289813 - 45289762
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
45289813 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
45289762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 47853976 - 47854027
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
47853976 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
47854027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 47854293 - 47854242
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47854293 |
ggcttaattgcacttttggacccctatatttccaaaagttgcggttatggac |
47854242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 52046029 - 52045978
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
52046029 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
52045978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 52114447 - 52114396
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
52114447 |
ggcttaattgcacttttggatccctatctttccaaaagttgcggttatggac |
52114396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 54215956 - 54216007
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
54215956 |
ggcttaattgcacttttggacccctatctttccgaaagttgcggttatggac |
54216007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 54556614 - 54556665
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54556614 |
ggcttaattgcacttttggacccctatttttccaaaagttgcggttatggac |
54556665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 55586930 - 55586879
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
55586930 |
ggcttaattgcacttttggacccctatctttccgaaagttgcggttatggac |
55586879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 389 - 435
Target Start/End: Complemental strand, 23770077 - 23770031
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23770077 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
23770031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Original strand, 24415073 - 24415123
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
24415073 |
ggcttaattgcacttttggacccctatctttccaaaagttgcagttatgga |
24415123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 437
Target Start/End: Original strand, 41707715 - 41707769
Alignment:
| Q |
383 |
attggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
41707715 |
attgacttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
41707769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 44921923 - 44921873
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
44921923 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
44921873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 388 - 434
Target Start/End: Original strand, 56296619 - 56296665
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
56296619 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatg |
56296665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 4902136 - 4902185
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
4902136 |
ggcttaattgcacttttggacccctatctttccaaaagttgctgttatgg |
4902185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 8891656 - 8891705
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
8891656 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggac |
8891705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 10046249 - 10046200
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
10046249 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
10046200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 17266062 - 17266013
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
17266062 |
ttggcttaattgcacttttggacccctatctttctaaaagttgcggttat |
17266013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 20466383 - 20466436
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
20466383 |
ttggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
20466436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 35364194 - 35364247
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
35364194 |
ttggcttaattgcacttttggacccctatctttttaaaagttgcggttatggac |
35364247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 47821475 - 47821524
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
47821475 |
ggcttaattgcacttttggacccctatctttcaaaaagttgcggttatgg |
47821524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 50513353 - 50513304
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
50513353 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
50513304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 381 - 437
Target Start/End: Complemental strand, 7644777 - 7644721
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||||| |||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7644777 |
ttataggcttaattgcacttttgaacccctatctttctaaaagttgcggttatggac |
7644721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 17554368 - 17554308
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
17554368 |
ttttttttgggcttaattgcacttttggacccctatcttttcaaaagttgcgattatggac |
17554308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 31209528 - 31209480
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31209528 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
31209480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 437
Target Start/End: Complemental strand, 39946391 - 39946339
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| ||||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
39946391 |
tggcttaattgcacttttggacccttatctttccaaaagttgtggttatggac |
39946339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 43822011 - 43821963
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
43822011 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatg |
43821963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 393 - 437
Target Start/End: Complemental strand, 51537737 - 51537693
Alignment:
| Q |
393 |
ttgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51537737 |
ttgcacttttggacccctatctttccaaaagttgcggttatggac |
51537693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 381 - 432
Target Start/End: Original strand, 3065955 - 3066006
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
3065955 |
ttataggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
3066006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 5344270 - 5344317
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
5344270 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
5344317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 7119594 - 7119645
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
7119594 |
ggcttaattgtacttttggatccctatctttccaaaagttgcggttatggac |
7119645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 7119907 - 7119856
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
7119907 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
7119856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 8482859 - 8482910
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
8482859 |
ggcttaattgcacttttggacccctattttttcaaaagttgcggttatggac |
8482910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 384 - 435
Target Start/End: Original strand, 10045954 - 10046004
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
10045954 |
ttggcttaattgcacttttggacccctatctttcc-aaagttgcggttatgg |
10046004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 14578753 - 14578702
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
14578753 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
14578702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 24542754 - 24542805
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
24542754 |
ggcttaattgcacttttggacccctatcttttcaaaagttacggttatggac |
24542805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 26675368 - 26675318
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
26675368 |
ggcttaattgcacttttggaccc-tatctttccaaaagttgcggttatggac |
26675318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 29548180 - 29548227
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
29548180 |
ggcttaattgcacttttggacccttatctttccaaaagttgcggttat |
29548227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 29627920 - 29627869
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29627920 |
ggcttagttgcatttttggacccctatctttccaaaagttgcggttatggac |
29627869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 389 - 436
Target Start/End: Original strand, 31250481 - 31250528
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31250481 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatgga |
31250528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 428
Target Start/End: Original strand, 36945504 - 36945555
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcg |
428 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| || ||||||||||| |
|
|
| T |
36945504 |
ttttttattggcttaattgcacttttggccccctatcttttcaaaagttgcg |
36945555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 38371271 - 38371322
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
38371271 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
38371322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 45289500 - 45289551
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| ||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
45289500 |
ggcttaaatgcacttttggacccctatcttttcaaaagttgcggttatggac |
45289551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 54556928 - 54556877
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
54556928 |
ggcttaattgcacttttggacctctatctttctaaaagttgcggttatggac |
54556877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 55586616 - 55586667
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
55586616 |
ggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggac |
55586667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 3770475 - 3770425
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||||| |||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
3770475 |
ttggcttaattgcacttttggacctctatcttttcaaaagttgcggttatg |
3770425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 18995118 - 18995068
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18995118 |
ttggcttaattgtatttttggacccctatctttccaaaagttgcggttatg |
18995068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 389 - 435
Target Start/End: Complemental strand, 19869468 - 19869422
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
19869468 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatgg |
19869422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 437
Target Start/End: Original strand, 31209225 - 31209275
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
31209225 |
gcttaattggacttttggacccatatctttccaaaagttgcggttatggac |
31209275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 35083901 - 35083843
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||||||||||| |||||||||| ||||| || ||||||||||| |||||||| |
|
|
| T |
35083901 |
tttttttggcttaattgcacttttggacctctatcttttcaaaagttgcgattatggac |
35083843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 437
Target Start/End: Complemental strand, 37289768 - 37289718
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
37289768 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
37289718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 54216277 - 54216219
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| |||||||||||| |||||| ||| ||||| || |||||||||||||||||||| |
|
|
| T |
54216277 |
ttttaatggcttaattgcacttttgaacctctatcttttcaaaagttgcggttatggac |
54216219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 8891968 - 8891915
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||| ||||||||||| || ||||||||| |||||||||| |
|
|
| T |
8891968 |
ttggcttaattgcactttaggacccctatcttttcaaaagttgtggttatggac |
8891915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 387 - 436
Target Start/End: Original strand, 17265850 - 17265899
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||| |||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
17265850 |
gcttaattgtacttttggacccctatctttctaaaagttgcggttatgga |
17265899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 389 - 434
Target Start/End: Original strand, 18994670 - 18994715
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
18994670 |
ttaattgcacttttggacccctatctttcgaaaagttgcggttatg |
18994715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 431
Target Start/End: Complemental strand, 33338343 - 33338298
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtt |
431 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||| |
|
|
| T |
33338343 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggtt |
33338298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 33508259 - 33508210
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||| | |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
33508259 |
ggcttaatttcacttttggacccctatctttccaaaagttgcggtaatgg |
33508210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 37432529 - 37432484
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
37432529 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttat |
37432484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 39332319 - 39332368
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
39332319 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttatgg |
39332368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 41787049 - 41787098
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
41787049 |
ggcttaattgcacttttggacccctatctttcaaaaaattgcggttatgg |
41787098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 42672070 - 42672115
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||| |||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
42672070 |
cttaattgcacttttggacccctatctttcaaaaagttgcggttat |
42672115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 46282760 - 46282809
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||| ||||||||| || |||||||||||||||||| |
|
|
| T |
46282760 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatgg |
46282809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 48277914 - 48277967
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| ||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
48277914 |
ttggcttaattgcatttttggacccctatcttttcaaaagttgtggttatggac |
48277967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 6387046 - 6386994
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccc-tatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
6387046 |
ggcttaattgcacttttggaccccctatctttctaaaagttgcggttatggac |
6386994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 6768800 - 6768848
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
6768800 |
ttaattgcacttttggacccttatctttctaaaagttgcggttatggac |
6768848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 437
Target Start/End: Complemental strand, 18988494 - 18988442
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| |||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
18988494 |
tggcttaattgcacttttggacccctatctttttaaaagttgcggctatggac |
18988442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 380 - 436
Target Start/End: Original strand, 28158890 - 28158946
Alignment:
| Q |
380 |
tttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||| || |||||||| |||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
28158890 |
tttatgggtttaattgcacttttggatccctatcttttcaaaagttgcggttatgga |
28158946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 34158474 - 34158522
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
34158474 |
ttaattgcatttttggacccctatctttccaaaaattgcggttatggac |
34158522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 34158783 - 34158735
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
34158783 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
34158735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 428
Target Start/End: Complemental strand, 36414023 - 36413979
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcg |
428 |
Q |
| |
|
||||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
36414023 |
ttggcttaattgcacttttggccccctatctttccaaaagttgcg |
36413979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 433
Target Start/End: Original strand, 37973516 - 37973560
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||||| |||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
37973516 |
ttaattgcacttttggacccctatctttctaaaagttgcggttat |
37973560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 37973828 - 37973780
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||| |||| ||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
37973828 |
ggcttagttgcacttttggactcctatctttccaaaagttgcggttatg |
37973780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 47821636 - 47821588
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| ||||| |||||||||| |||| ||||||||||||||| |
|
|
| T |
47821636 |
ggcttaattgcacttttagacccctatctttccgaaagttgcggttatg |
47821588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 17262090 - 17262141
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| || ||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
17262090 |
ggcttaattgcactcttggaccactatcttttcaaaagttgcggttatggac |
17262141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 436
Target Start/End: Complemental strand, 24543053 - 24543006
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||| |||||||| |
|
|
| T |
24543053 |
ttaattgcacttttggacccctatcttttcaaaagttgcagttatgga |
24543006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 26171241 - 26171292
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| || |||||||||| ||||||||| |
|
|
| T |
26171241 |
ggcttaattgcacttttggacccttatcttttcaaaagttgcagttatggac |
26171292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 27751163 - 27751214
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
27751163 |
ggcttaattgcacttttggacctctatgtttccaaaagttgtggttatggac |
27751214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 381 - 436
Target Start/End: Original strand, 28981908 - 28981963
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||| |||||| ||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
28981908 |
ttataggcttatatgcacttttggacccctatcttttcaaaagttgcggttatgga |
28981963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 29432360 - 29432309
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||| ||||||||||| |
|
|
| T |
29432360 |
ggcttaattgcacttttggatccctatcttttcaaaagttacggttatggac |
29432309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 30998183 - 30998234
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| ||| ||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
30998183 |
ggcttaactgcacttttagacctctatctttccaaaagttgcggttatggac |
30998234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 35835776 - 35835827
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||| || ||||||||||| |
|
|
| T |
35835776 |
ggcttaattgcacttttggacccctatcttttcaaaatttacggttatggac |
35835827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 39946080 - 39946131
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
39946080 |
ggcttaattgcacttttggaccattatctttctaaaagttgcggttatggac |
39946131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 380 - 427
Target Start/End: Original strand, 44822433 - 44822480
Alignment:
| Q |
380 |
tttattggcttaattgctcttttggacccctatcgttccaaaagttgc |
427 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||| ||||||||||||| |
|
|
| T |
44822433 |
tttataggcttaattgcacctttggacccctatctttccaaaagttgc |
44822480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 432
Target Start/End: Complemental strand, 3066840 - 3066794
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||| ||||||||||| || | |||||||||||||||||| |
|
|
| T |
3066840 |
ggcttaattgcacttttggacccataactttccaaaagttgcggtta |
3066794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 437
Target Start/End: Original strand, 19693018 - 19693068
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||| ||||| |||| |
|
|
| T |
19693018 |
gcttaattgcacttttggacccctaactttccaaaagttgtggttacggac |
19693068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 437
Target Start/End: Original strand, 19703603 - 19703653
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||| ||||| |||| |
|
|
| T |
19703603 |
gcttaattgcacttttggacccctaactttccaaaagttgtggttacggac |
19703653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 381 - 427
Target Start/End: Complemental strand, 21537195 - 21537149
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgc |
427 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||| || |||||||||| |
|
|
| T |
21537195 |
ttataggcttaattgcacttttggacccctatcttttcaaaagttgc |
21537149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 389 - 431
Target Start/End: Original strand, 29432050 - 29432092
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggtt |
431 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| |||||||| |
|
|
| T |
29432050 |
ttaattgcacttttggacccctatctttccaaaaattgcggtt |
29432092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 434
Target Start/End: Original strand, 33338047 - 33338097
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||||| ||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
33338047 |
ttggcttaattgtacttttggacccatatatttccaaaagttgcggttatg |
33338097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 436
Target Start/End: Original strand, 50513045 - 50513095
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| ||||||||| |||||| || |||||||||| |||||||| |
|
|
| T |
50513045 |
ggcttaattgcacttttggactcctatcttttcaaaagttgcagttatgga |
50513095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 3770179 - 3770228
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||| |||||| |
|
|
| T |
3770179 |
ggcttaattgcacttttggacccctatctttcttaaagttgcgattatgg |
3770228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 6769107 - 6769058
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| | |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
6769107 |
cttaattacacttttggacccctatcttttcaaaagttgtggttatggac |
6769058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 404 - 437
Target Start/End: Complemental strand, 20466680 - 20466647
Alignment:
| Q |
404 |
gacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
20466680 |
gacccctatctttccaaaagttgcggttatggac |
20466647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 437
Target Start/End: Complemental strand, 23419645 - 23419596
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| || |||||||| |||||||||| |
|
|
| T |
23419645 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggac |
23419596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 39332611 - 39332562
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||| ||||||||| || ||||||||||||||||| |
|
|
| T |
39332611 |
ggcttaattgcacttttgaacccctatctttttaaaagttgcggttatgg |
39332562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 1377900 - 1377852
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||| |||||| |||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
1377900 |
ggctaaattgcactttaggacccctatcttttcaaaagttgcggttatg |
1377852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 31843790 - 31843838
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| | |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
31843790 |
ttaattacacttttggacccctatcttttcaaaagttgtggttatggac |
31843838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 435
Target Start/End: Complemental strand, 46283059 - 46283005
Alignment:
| Q |
384 |
ttggcttaattgctct---tttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| || |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
46283059 |
ttggcttaattgcactatctttggacccctatctttctaaaagttgcggttatgg |
46283005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 139496 - 139436
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
139496 |
ttttttaatggtttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
139436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 139178 - 139226
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
139178 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatggac |
139226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 2e-16; HSPs: 92)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 437
Target Start/End: Original strand, 6261380 - 6261432
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6261380 |
tggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
6261432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 437
Target Start/End: Complemental strand, 34705698 - 34705638
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
34705698 |
tttttttttggcttaattgcacttttggacccctatctttctaaaagttgcggttatggac |
34705638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 4405554 - 4405503
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4405554 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
4405503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 6261690 - 6261639
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6261690 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
6261639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 7391485 - 7391536
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7391485 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
7391536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 11213496 - 11213445
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11213496 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
11213445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 13042408 - 13042459
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13042408 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
13042459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 436
Target Start/End: Complemental strand, 13042722 - 13042671
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13042722 |
tggcttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
13042671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 23291256 - 23291307
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23291256 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
23291307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 31951514 - 31951463
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31951514 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
31951463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 377 - 435
Target Start/End: Complemental strand, 10894192 - 10894134
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||| ||||||||||||| |||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
10894192 |
tttttttttggcttaattgcacttttggacctctatctttccaaaagttgcggttatgg |
10894134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 379 - 437
Target Start/End: Complemental strand, 27223629 - 27223571
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
27223629 |
ttttataggcttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
27223571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 1814974 - 1815027
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
1814974 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
1815027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 10893889 - 10893938
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10893889 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
10893938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 10977656 - 10977709
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
10977656 |
ttggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
10977709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 380 - 437
Target Start/End: Complemental strand, 11322344 - 11322287
Alignment:
| Q |
380 |
tttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
11322344 |
tttataggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
11322287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 11745998 - 11746047
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11745998 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
11746047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 15272998 - 15273047
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15272998 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
15273047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 20080118 - 20080167
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20080118 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
20080167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 23883403 - 23883350
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
23883403 |
ttggcttaattgcacttttggacccctatctttctaaaagttgcggttatggac |
23883350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 25749955 - 25750004
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25749955 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
25750004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 26716684 - 26716635
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26716684 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
26716635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 437
Target Start/End: Original strand, 22279490 - 22279550
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| || |||||||||| ||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
22279490 |
ttttttttttgcttaattgcacttttggactcctatctttccaaaagttgcggttatggac |
22279550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 27765261 - 27765309
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27765261 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
27765309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 433
Target Start/End: Complemental strand, 28930786 - 28930730
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
28930786 |
tttttttttggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
28930730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 1815289 - 1815238
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
1815289 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatggac |
1815238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 1896898 - 1896945
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1896898 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
1896945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 7391790 - 7391739
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
7391790 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
7391739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 11614898 - 11614949
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
11614898 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatggac |
11614949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 14997009 - 14997060
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14997009 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
14997060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 16735878 - 16735827
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16735878 |
ggcttaattgcacttttggacccctatttttccaaaagttgcggttatggac |
16735827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 29697156 - 29697105
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
29697156 |
ggcttaattgcacttttggacccctatctttccaaaagttgcagttatggac |
29697105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 30966005 - 30965954
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
30966005 |
ggcttaattgcacttttggacccttatctttccaaaagttgcggttatggac |
30965954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 31833579 - 31833528
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
31833579 |
ggcttaattgcacttttggacccctatctttccaaaaattgcggttatggac |
31833528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Original strand, 2565078 - 2565128
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
2565078 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
2565128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 2565392 - 2565342
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
2565392 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
2565342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 377 - 435
Target Start/End: Complemental strand, 3535101 - 3535043
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
3535101 |
tttttttttggtttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
3535043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 11445969 - 11446027
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
11445969 |
ttttattggtttaattgcacttttggacctctatcttttcaaaagttgcggttatggac |
11446027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 435
Target Start/End: Complemental strand, 11746293 - 11746243
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
11746293 |
tggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
11746243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 384 - 434
Target Start/End: Original strand, 16765039 - 16765089
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16765039 |
ttggcttaattgtacttttggacccctatctttccaaaagttgcggttatg |
16765089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 388 - 434
Target Start/End: Complemental strand, 31741082 - 31741036
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31741082 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatg |
31741036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 15149725 - 15149778
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| ||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
15149725 |
ttggcttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
15149778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 23883087 - 23883140
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| ||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
23883087 |
ttggcttaattgcacttttggacccttatcttttcaaaagttgcggttatggac |
23883140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 377 - 434
Target Start/End: Original strand, 31833257 - 31833314
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||||| || |||||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
31833257 |
ttttttttttgcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
31833314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 2100380 - 2100428
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
2100380 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatg |
2100428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 436
Target Start/End: Original strand, 3195718 - 3195766
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
3195718 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
3195766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 9703854 - 9703806
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
9703854 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
9703806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 437
Target Start/End: Complemental strand, 20630663 - 20630611
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||| ||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
20630663 |
tggcttaattgcacttttagacctctatctttccaaaagttgcggttatggac |
20630611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 378 - 437
Target Start/End: Original strand, 28563318 - 28563378
Alignment:
| Q |
378 |
tttttatt-ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| | ||| ||||||||||||||||||| |
|
|
| T |
28563318 |
tttttattaggcttaattgcacttttggacccctacctttctaaaagttgcggttatggac |
28563378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 432
Target Start/End: Complemental strand, 28932952 - 28932904
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
28932952 |
ttggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
28932904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 374 - 437
Target Start/End: Original strand, 30965681 - 30965742
Alignment:
| Q |
374 |
ttcttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||| || |||||||||| ||||||||| |
|
|
| T |
30965681 |
ttctttttta--ggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggac |
30965742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 2100694 - 2100643
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
2100694 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
2100643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 3185470 - 3185419
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
3185470 |
ggcttaattgcacttttggtcccctatcttttcaaaagttgcggttatggac |
3185419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 388 - 435
Target Start/End: Original strand, 3534800 - 3534847
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||| | |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3534800 |
cttaattacacttttggacccctatctttccaaaagttgcggttatgg |
3534847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 5606296 - 5606347
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||| ||||||| || |||||||||||||||||||| |
|
|
| T |
5606296 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
5606347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 5606610 - 5606559
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
5606610 |
ggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggac |
5606559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 390 - 437
Target Start/End: Original strand, 12256768 - 12256815
Alignment:
| Q |
390 |
taattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
12256768 |
taattgcacttttggacccctatcttttcaaaagttgcggttatggac |
12256815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 12257077 - 12257026
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
12257077 |
ggcttaattgcacttttggacctttatctttccaaaagttgcggttatggac |
12257026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 433
Target Start/End: Complemental strand, 14997322 - 14997275
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
14997322 |
ggcttaattgcacttttggacccctatctttgcaaaagttgcggttat |
14997275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 18683323 - 18683272
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| | ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18683323 |
ggcttaatttcacttttggacccctatttttccaaaagttgcggttatggac |
18683272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 20630352 - 20630399
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
20630352 |
ggcttaattgcacttatggacccctatctttccaaaagttgcggttat |
20630399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 21003368 - 21003419
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||| |||| |
|
|
| T |
21003368 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggttacggac |
21003419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 26171520 - 26171469
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||| ||||| |||||||| |
|
|
| T |
26171520 |
ggcttaattgcacttttggacccctatctttccaaaacttgcgattatggac |
26171469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 28563633 - 28563582
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
28563633 |
ggcttaattgcacttttggacctctatctttcaaaaagttgcggttatggac |
28563582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 29696848 - 29696899
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
29696848 |
ggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggac |
29696899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 30239517 - 30239466
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
30239517 |
ggcttaattgcacttttagacccctatctttccaaaagttgcagttatggac |
30239466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 31740769 - 31740820
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
31740769 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
31740820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 389 - 435
Target Start/End: Complemental strand, 15273289 - 15273243
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
15273289 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
15273243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 437
Target Start/End: Original strand, 28930465 - 28930515
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
28930465 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttatggac |
28930515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 432
Target Start/End: Original strand, 28931949 - 28931995
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
28931949 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
28931995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 437
Target Start/End: Original strand, 30818219 - 30818269
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| ||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
30818219 |
gcttgattgcacttttggacccctatcttttcaaaagttgcggttatggac |
30818269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 18683010 - 18683063
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||||| |||||||||| ||||| || ||||||||| |||||||||| |
|
|
| T |
18683010 |
ttggcttaattgcacttttggacctctatcttttcaaaagttgtggttatggac |
18683063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 1897192 - 1897144
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
1897192 |
ggcttaattgcatttttgaacccctatctttccaaaagttgcggttatg |
1897144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 381 - 437
Target Start/End: Complemental strand, 3196030 - 3195974
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||| |||||||| || |||| || ||||||||| |||||||||| |
|
|
| T |
3196030 |
ttattggcttaattgcacttttggatccttatcttttcaaaagttgtggttatggac |
3195974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 10977968 - 10977920
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
10977968 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
10977920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 15150038 - 15149990
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
15150038 |
ttaattgcacttttagacccctatcttttcaaaagttgcggttatggac |
15149990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 426
Target Start/End: Complemental strand, 23585291 - 23585251
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttg |
426 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
23585291 |
ggcttaattgcacttttggacccctatctttccaaaagttg |
23585251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 11277626 - 11277673
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
11277626 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttat |
11277673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 13440189 - 13440138
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||| | |||| |||||||||||||||||| |||| |
|
|
| T |
13440189 |
ggcttaattgcacttttggactcttatctttccaaaagttgcggttacggac |
13440138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 15711949 - 15711898
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
15711949 |
ggcttaattgcacttttcgacccctatctttttaaaagttgcggttatggac |
15711898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 380 - 435
Target Start/End: Complemental strand, 20080418 - 20080363
Alignment:
| Q |
380 |
tttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||| |||||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
20080418 |
tttataggcttaattgtacttttggacccctatctttgtaaaagttgcggttatgg |
20080363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 435
Target Start/End: Complemental strand, 26479358 - 26479307
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| |||||||| |||||| ||||||||||||| ||||||| |
|
|
| T |
26479358 |
ttggcttaattgcacttttggatccctatttttccaaaagttgcagttatgg |
26479307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 30818528 - 30818477
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||| | ||||||| || |||||||||||||||||||| |
|
|
| T |
30818528 |
ggcttaattgcacttttgaatccctatcttttcaaaagttgcggttatggac |
30818477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 3194749 - 3194699
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| ||||||||| | |||| ||| |||||||||||||||||| |
|
|
| T |
3194749 |
ggcttaattgcacttttggactcatatctttctaaaagttgcggttatgga |
3194699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 424
Target Start/End: Complemental strand, 9126688 - 9126650
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagt |
424 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
9126688 |
ggcttaattgcacttttggacccctatctttccaaaagt |
9126650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 389 - 434
Target Start/End: Complemental strand, 11277927 - 11277882
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
11277927 |
ttaattgtacttttggacccctatcttttcaaaagttgcggttatg |
11277882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 378 - 434
Target Start/End: Complemental strand, 17966159 - 17966103
Alignment:
| Q |
378 |
tttttattggcttaattgctcttttgga-cccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||| ||||||||||||| |||||||| |||||||| |||| ||||||||||||||| |
|
|
| T |
17966159 |
ttttttttggcttaattgcacttttggaccccctatctttcc-aaagttgcggttatg |
17966103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 27771529 - 27771476
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| | ||||||||||| |||| || ||||||||||||||||||| |
|
|
| T |
27771529 |
ttggcttaattacacttttggacccttatctttttaaaagttgcggttatggac |
27771476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 13439880 - 13439928
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||| || |||||| |||||||||||||| |||||||| |
|
|
| T |
13439880 |
ttaattgcacttttgaactcctatctttccaaaagttgcgtttatggac |
13439928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 436
Target Start/End: Original strand, 15711637 - 15711685
Alignment:
| Q |
389 |
ttaattgctcttttggacc-cctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||||| |||||||||| |||||| || ||||||||||||||||||| |
|
|
| T |
15711637 |
ttaattgcacttttggacctcctatcttttcaaaagttgcggttatgga |
15711685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 22279808 - 22279760
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||| ||||||||| || ||||| |||||||||||||| |
|
|
| T |
22279808 |
ttaattgcacttttgaacccctatcttttcaaaaattgcggttatggac |
22279760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 31951208 - 31951256
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
31951208 |
ttaattgcatttttggacccctatctttttaaaagttgcggttatggac |
31951256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0922 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0922
Description:
Target: scaffold0922; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 146 - 95
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
146 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
95 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0606 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 6868 - 6919
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6868 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
6919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0594
Description:
Target: scaffold0594; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 5906 - 5855
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5906 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
5855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 5592 - 5640
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5592 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
5640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 7721 - 7772
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7721 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
7772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 387 - 437
Target Start/End: Complemental strand, 8033 - 7983
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8033 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
7983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 44; Significance: 7e-16; HSPs: 4)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 10941 - 10890
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10941 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
10890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 16231 - 16180
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16231 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
16180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 10628 - 10679
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| |||||||||||||| |||||||| |
|
|
| T |
10628 |
ggcttaattgcacttttagacccctatctttccaaaagttgcgattatggac |
10679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 15918 - 15969
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||| |||||||||| |||||||||||||| |||||||| |
|
|
| T |
15918 |
ggcttaattgcacttttagacccctatctttccaaaagttgcgattatggac |
15969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0213
Description:
Target: scaffold0213; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 384 - 435
Target Start/End: Complemental strand, 21362 - 21311
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21362 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
21311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 382 - 435
Target Start/End: Original strand, 21062 - 21115
Alignment:
| Q |
382 |
tattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| |||||||| ||||| |||||| |
|
|
| T |
21062 |
tattggcttaattgcacttttggatccctatctttccaaaatttgcgattatgg |
21115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 29650 - 29701
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29650 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
29701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 29964 - 29913
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
29964 |
ggcttaattgcacttttggacccctatctttccaaaagttacggttatggac |
29913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 384 - 435
Target Start/End: Original strand, 22293 - 22344
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22293 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
22344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 384 - 435
Target Start/End: Complemental strand, 22591 - 22540
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22591 |
ttggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
22540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 81615 - 81564
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
81615 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
81564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 379 - 437
Target Start/End: Original strand, 81298 - 81356
Alignment:
| Q |
379 |
ttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||||| |||||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
81298 |
ttttatttgcttaattgcacttttgaacccctatctttccaaaagttgtggttatggac |
81356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 385 - 435
Target Start/End: Complemental strand, 16068 - 16018
Alignment:
| Q |
385 |
tggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16068 |
tggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
16018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0951 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0951
Description:
Target: scaffold0951; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 437
Target Start/End: Original strand, 3703 - 3756
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||| |||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3703 |
ttggtttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
3756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 4834 - 4786
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4834 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
4786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 238937 - 238889
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
238937 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
238889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 238622 - 238673
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
238622 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggac |
238673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1171 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold1171
Description:
Target: scaffold1171; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 819 - 870
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
819 |
ggcttaattgcacttttggacccctatctttccaaaagttgcgtttatggac |
870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0777 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0777
Description:
Target: scaffold0777; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 183 - 132
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
183 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatggac |
132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 9947 - 9998
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
9947 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatggac |
9998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 10250 - 10200
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
10250 |
ggcttaattgcatttttggacccctatctttctaaaagttgcggttatgga |
10200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 3)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 20927 - 20876
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||| |||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20927 |
ggcttatttgcacttttggacccctatctttccaaaagttgcggttatggac |
20876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 381 - 437
Target Start/End: Original strand, 12042 - 12098
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||| |||||||| |||||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
12042 |
ttattggtttaattgcacttttggacctctatcttttcaaaagttgcggttatggac |
12098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 434
Target Start/End: Original strand, 20595 - 20643
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| |||||||||||||||| || ||||||||||||||||| |
|
|
| T |
20595 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
20643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 20939 - 20888
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
20939 |
ggcttaattgcacttttggacccttatctttccaaaagttgcggttatggac |
20888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 79300 - 79249
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
79300 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
79249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 12971 - 12921
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
12971 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatgga |
12921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 78990 - 79039
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
78990 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatgg |
79039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 38; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 2646 - 2695
Alignment:
| Q |
388 |
cttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
2646 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggac |
2695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 381 - 437
Target Start/End: Complemental strand, 2963 - 2907
Alignment:
| Q |
381 |
ttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||| ||| |||||||| |||||||||| |
|
|
| T |
2963 |
ttattggcttaattgcacttttggacccttatttttctaaaagttggggttatggac |
2907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: scaffold0283
Description:
Target: scaffold0283; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Original strand, 1187 - 1235
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
1187 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
1235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 1494 - 1446
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| ||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
1494 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
1446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 14615 - 14567
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
|||||||| |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
14615 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
14567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272 (Bit Score: 36; Significance: 0.00000000004; HSPs: 3)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Complemental strand, 10874 - 10823
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
10874 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggac |
10823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 386 - 435
Target Start/End: Complemental strand, 21162 - 21113
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
21162 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggtaatgg |
21113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 20868 - 20915
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttat |
433 |
Q |
| |
|
||||||||||| |||||||||| ||||| || |||||||||||||||| |
|
|
| T |
20868 |
ggcttaattgcacttttggacctctatcttttcaaaagttgcggttat |
20915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 75110 - 75161
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
75110 |
ggcttaattgcacttttggacccctatttttccaaaagttgccgttatggac |
75161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 436
Target Start/End: Complemental strand, 75397 - 75338
Alignment:
| Q |
377 |
ttttttattggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
|||||| |||| |||||||| ||||||||| |||||| || ||||||||||||||||||| |
|
|
| T |
75397 |
tttttttttggtttaattgcacttttggactcctatcttttcaaaagttgcggttatgga |
75338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 432
Target Start/End: Original strand, 21838 - 21884
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggtta |
432 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
21838 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
21884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0592 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0592
Description:
Target: scaffold0592; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 386 - 434
Target Start/End: Complemental strand, 9023 - 8975
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
9023 |
ggcttaattgcatttttggacccctatctttccaaaagttgtggttatg |
8975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 391 - 435
Target Start/End: Complemental strand, 26555 - 26511
Alignment:
| Q |
391 |
aattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
26555 |
aattgcacttttggacctctatctttccaaaagttgcggttatgg |
26511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 387 - 435
Target Start/End: Original strand, 26264 - 26312
Alignment:
| Q |
387 |
gcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||||| |||||| || |||||| || |||||||||||||||||| |
|
|
| T |
26264 |
gcttaattgcacttttgaactcctatcttttcaaaagttgcggttatgg |
26312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 437
Target Start/End: Original strand, 763 - 814
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatggac |
437 |
Q |
| |
|
||||||||||| |||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
763 |
ggcttaattgcatttttagacccctatctttccaaaagttgcggttacggac |
814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 427
Target Start/End: Original strand, 31977 - 32020
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgc |
427 |
Q |
| |
|
||||||||||||| ||||||| |||||||| ||||||||||||| |
|
|
| T |
31977 |
ttggcttaattgcacttttggccccctatctttccaaaagttgc |
32020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: scaffold1067
Description:
Target: scaffold1067; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 389 - 435
Target Start/End: Complemental strand, 1645 - 1600
Alignment:
| Q |
389 |
ttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
1645 |
ttaattgcacttttggaccc-tatctttccaaaagttgcggttatgg |
1600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 435
Target Start/End: Original strand, 1355 - 1404
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcggttatgg |
435 |
Q |
| |
|
||||||||||| |||||||| ||||||| || ||||||||||||| |||| |
|
|
| T |
1355 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggtcatgg |
1404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 434
Target Start/End: Original strand, 16517 - 16567
Alignment:
| Q |
384 |
ttggcttaattgctcttttggacccctatcgttccaaaagttgcggttatg |
434 |
Q |
| |
|
|||| ||||||||||||||||| |||||| || ||||||||||||||||| |
|
|
| T |
16517 |
ttggtttaattgctcttttggattcctatcttttcaaaagttgcggttatg |
16567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 390 - 436
Target Start/End: Original strand, 3787 - 3832
Alignment:
| Q |
390 |
taattgctcttttggacccctatcgttccaaaagttgcggttatgga |
436 |
Q |
| |
|
||||||| ||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
3787 |
taattgcacttttggaccc-tatctttccaaaagttgcggttatgga |
3832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 428
Target Start/End: Complemental strand, 122643 - 122601
Alignment:
| Q |
386 |
ggcttaattgctcttttggacccctatcgttccaaaagttgcg |
428 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
122643 |
ggcttaattgcacttttggccccctatctttccaaaagttgcg |
122601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University