View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2734_high_21 (Length: 298)
Name: NF2734_high_21
Description: NF2734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2734_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 11047551 - 11047313
Alignment:
| Q |
1 |
ttaaattgtgatttctctttgcttgttctcactgtgagggtcagaggggaaaatctcagtaggtccaattacaaagatgtggtctctaagctttagatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11047551 |
ttaaattgtgatttctctttgcttgttctcactgtgagggtcagaggggaaaatctcagtaggtccaattacaaagatgtggtctctaagctttagatct |
11047452 |
T |
 |
| Q |
101 |
tactatagtgataaaactctgtagannnnnnnnnnnncatttccccatatacagcctgttctcttcttcttctttctatgaaaagttcgtgcatgcattg |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11047451 |
tactatagtgataaaactctgtagatttctctctctccatttccccatatacagcctgttctcttcttcttctttctatgaaaagttcgtgcatgcattg |
11047352 |
T |
 |
| Q |
201 |
tacggtagtaccgacaatattttctgctactgccaaata |
239 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11047351 |
tacggtagtaccgacaatattttcagctactgccaaata |
11047313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University