View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2734_high_26 (Length: 250)
Name: NF2734_high_26
Description: NF2734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2734_high_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 9554275 - 9554036
Alignment:
| Q |
1 |
ccttggttagctggtggattttcaatgagtgtgacatggacttatataatagctgaggaacttgtttcacttttgatttcaattggatatgtaattggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9554275 |
ccttggttagctggtggattttcaatgagtgtgacatggacttatataatagctgaggaacttgtttcacttttgatttcaattggatatgtaattggtg |
9554176 |
T |
|
| Q |
101 |
ttagtccttcaattttagggttaaccgttttggcttggggaaattctctaggtgatttgatagcaaatggtgctatggctaaaaatggcggtgttgatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9554175 |
ttagtccttcaattttagggttaaccgttttggcttggggaaattctctaggtgatttgatagcaaatggtgctatggctaaaaatggtggtgttgatgg |
9554076 |
T |
|
| Q |
201 |
tgcacaaattgctgtttcaggttgttatgctggtcctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9554075 |
tgcacaaattgctgtttcaggttgttatgctggtcctatg |
9554036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 161
Target Start/End: Original strand, 9552649 - 9552709
Alignment:
| Q |
101 |
ttagtccttcaattttagggttaaccgttttggcttggggaaattctctaggtgatttgat |
161 |
Q |
| |
|
||||||||||||||||||||||||| ||| | |||||||| || || | ||||||||||| |
|
|
| T |
9552649 |
ttagtccttcaattttagggttaacggttctagcttggggtaactcaattggtgatttgat |
9552709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University