View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2734_low_16 (Length: 367)
Name: NF2734_low_16
Description: NF2734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2734_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 18 - 352
Target Start/End: Complemental strand, 45452045 - 45451711
Alignment:
| Q |
18 |
cggagggtctagattgattaaaagtatgaacaggtcttatgatgaacatgaaagttaaagaaaccattgctggaccaactgctatgatgaaaatcaaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45452045 |
cggagggtctagattgattaaaagtatgaacaggtcttatgatgaacatgaaagttaaagaaaccattgctggaccaactgctatgatgaaaatcaaaga |
45451946 |
T |
|
| Q |
118 |
ggcttgatcagggagattaatcatagctattatttgagtccaaattgcgccacttaagccaacgaatcctttcaatatcccgaccacggggcctcggttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45451945 |
ggcttgatcagggagattaatcatagctattatttgagtccaaattgcgccacttaagccaacgaatcctttcaatatccctaccacggggcctcggttt |
45451846 |
T |
|
| Q |
218 |
tctgggaaactttgcacacaggaaaccaatgctgccgtgttgtagtacgttgaaccattttgtcccaccaagatgaaaaagcatagctgcaagttatcaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45451845 |
tctgggaaactttgcacacaggaaaccaatgctgccgtgttgtagtacgttgaaccattttgtcccaccaagatgaaaaagcatagctgcaagttatcaa |
45451746 |
T |
|
| Q |
318 |
tctccggttaacaattttagttcacatgtttttat |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45451745 |
tctccggttaacaattttagttcacatgtttttat |
45451711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University