View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2734_low_23 (Length: 284)
Name: NF2734_low_23
Description: NF2734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2734_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 15 - 274
Target Start/End: Complemental strand, 28753280 - 28753021
Alignment:
| Q |
15 |
aggccaaaacgaggtgtaaaagaagtaacaggaacaaaggatttgagtgaagatgtggagacaatgactaagcagagacaagagttgcagttattgcaag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28753280 |
aggccaaaacgaggtgtaaaagaagtaacaggaacaaaggatttgagtgaagatgtggagacaatgactaagcagagacaagagttgcagttattgcaag |
28753181 |
T |
 |
| Q |
115 |
agaagattaaagaacatttcgaggctggctcaaattcgaatttaaccgtgtcagaaatggcagaaaaaattgatgagcttgttacaaaagtgattagttt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28753180 |
agaagattaaagaacatttcgaggctggctcaaattcgactttaaccgtgtcagaaatggcagaaaaaattgatgagcttgttacaaaagtgattagttt |
28753081 |
T |
 |
| Q |
215 |
agaatctgctgtttcttctcaaacagctttggtaaagaatttaaaagatgaaactgatga |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28753080 |
agaatctgctgtttcttctcaaacagctttggtaaagaatttaaaagatgaaactgatga |
28753021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University