View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2735_high_7 (Length: 249)
Name: NF2735_high_7
Description: NF2735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2735_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 127 - 238
Target Start/End: Original strand, 47933002 - 47933113
Alignment:
| Q |
127 |
cgcataactagtcaaacttatgttttggttacccaaaaatgttttcgtagattaatttgatatcttccggttaactttaaccacaaatgattaaggtaga |
226 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||| |||| |||||||||||||||||||||||||||||| || |
|
|
| T |
47933002 |
cgcataattagtcaaacttatgttttggttacccaaaaatgttttcgtcagttagtttgatctcttacggttaactttaaccacaaatgattaaggtgga |
47933101 |
T |
 |
| Q |
227 |
ccaatattgtag |
238 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47933102 |
ccaatattgtag |
47933113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 66
Target Start/End: Original strand, 47932888 - 47932941
Alignment:
| Q |
13 |
aatatatatatttattactcaaaagattttgctgactcttatttaacgttagtc |
66 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
47932888 |
aatatatatatttatggctcaaaagactttgctgactcttatttaacattagtc |
47932941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University