View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2735_low_10 (Length: 239)
Name: NF2735_low_10
Description: NF2735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2735_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 5947636 - 5947458
Alignment:
| Q |
12 |
caagaatatgaaaagtaaagtaaagtaaagtaaagagaaagaatagaaattacctttgtacgaggacaaagcccttgggtttgctcatgatacttaaaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5947636 |
caagaatatgaaaagtaaagtaaagtaaag---ag-gaaagaatagaaattacctttgtacgaggacaaagccctcgggtttgctcatgatacttaaaat |
5947541 |
T |
|
| Q |
112 |
cagcgagttcggatgagaattggtaagatggattggaaggatcctgacgaaaagctcgtttgaagtaaacagctgcagtgtca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5947540 |
cagcgagttcggatgagaattggtaagatggattggaaggatcctgacgaaaagctcgtttgaagtaaacagctgcagcgtca |
5947458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 131 - 211
Target Start/End: Complemental strand, 15397393 - 15397313
Alignment:
| Q |
131 |
ttggtaagatggattggaaggatcctgacgaaaagctcgtttgaagtaaacagctgcagtgtcaaagtaaagtttagcgtc |
211 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||| |
|
|
| T |
15397393 |
ttggtaagttggatcggaaggatcctgacgaaaagctcgtttgaagtaaacatctgcactgtcaaagtgaagtttagcgtc |
15397313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University