View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2735_low_11 (Length: 214)
Name: NF2735_low_11
Description: NF2735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2735_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 23 - 199
Target Start/End: Original strand, 33732515 - 33732691
Alignment:
| Q |
23 |
atgacactaaatctccacctaaaatcttaagacgttgaatattatgaatcatctcttttatatatctaacaccactttttgcattcatagtcgaggtgaa |
122 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
33732515 |
atgacactaaatctccacctaaaaccttaagacgttgaatattatgaatcacctcttttatatatctaacaccacttttagcattcagagtcgaggtgaa |
33732614 |
T |
 |
| Q |
123 |
actaaattactcacaccagaactatacaaaagatctcatacaagattgcactaatgtaaaaaattgatggaaaatag |
199 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33732615 |
actaaatcagtcacaccagaactatacaaaagatctcatacaagattgcactaatgtaaaaaattgatggaaaatag |
33732691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University