View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2736_high_34 (Length: 290)
Name: NF2736_high_34
Description: NF2736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2736_high_34 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 290
Target Start/End: Original strand, 31680016 - 31680296
Alignment:
| Q |
13 |
atactgttagagggaaaaatgtctcaaatcttacttttttctttgcctgtgtttttgaaacatcattgccccagcattttaannnnnnnng----aagag |
108 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
31680016 |
atactgttagagggaaaattgtctcaaatcttacttttttctttgcctgtgtttttgaaacatcattgccctagcattttaattgtttttttttaaagag |
31680115 |
T |
 |
| Q |
109 |
tctaacgacgaaacccacatactaaatacggaggagtacaagcttggatggaagttatgacatggggaagagactctctagtatgaagtgttgaaagcga |
208 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31680116 |
tctaacgacgaa-cccacatactaaatacagaggagtacaagcttggctggaagttatgacatggggaagagactctctagtatgaagtgttgaaagcga |
31680214 |
T |
 |
| Q |
209 |
aatatggtagagagaatcttcacatgaataatgttgtggctaagcaagttgattcaagtttatggatggctttggttgagga |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31680215 |
aatatggtagagagaatcttcacatgaataatgttgtggctgagcaagtttattcaagtttatggatggctttggttgagga |
31680296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University