View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2736_high_35 (Length: 279)
Name: NF2736_high_35
Description: NF2736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2736_high_35 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 13 - 279
Target Start/End: Original strand, 30496750 - 30497017
Alignment:
| Q |
13 |
aatattggtactgttgagttgagtagtcagagagaacacacagcgtgcagtggctagtctcatggattggagaaacctatttcttcttctattaatcaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30496750 |
aatattggtactgttgagttgagtagtcagagagaacacacagcgtgcagtggctagtctcatggattggagaaacctatttcttcttctattaatcaga |
30496849 |
T |
 |
| Q |
113 |
aattgcagtcactaggcttaaatcaagcagttatggggaaggtaaattttgttcagctttactgattc-ttttggcttcaattgcccgatctgttccctc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30496850 |
aattgcagtcactaggcttaaatcaagcagttatggggaaggtaaattttgttcagctttactgattctttttggcttcaattgcccgatctgttccctc |
30496949 |
T |
 |
| Q |
212 |
gtagtatgagatgagtagtatagtagtatagtacacaaacatgacttaattacatacaatttgggtga |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30496950 |
gtagtatgagatgagtagtatagtagtatagtacacaaacatgacttaattacatacaatttgggtga |
30497017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University