View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2736_high_8 (Length: 488)
Name: NF2736_high_8
Description: NF2736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2736_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 1e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 195 - 476
Target Start/End: Original strand, 246990 - 247271
Alignment:
| Q |
195 |
aatagcatgaatttgtgaacatgattagtttctaaagtaacaggtatccgagaaggtggcagcgtcgtcaggaacatccttcattacccattcatggcca |
294 |
Q |
| |
|
|||| |||||||| | |||||||||||||||| ||||||||||| || |||||||||||||| | ||||||||||| | ||||||||||||||||||| |
|
|
| T |
246990 |
aataacatgaattagaaaacatgattagtttctgaagtaacaggtctcggagaaggtggcagcaccatcaggaacatcttccattacccattcatggcca |
247089 |
T |
 |
| Q |
295 |
tcagggaagtaaattccagtccttgggtgtggaacccagtaacttgaatatgatgatgacgatgactccaatactgccttcttccctacactactactct |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
247090 |
acagggaagtaaattccagtccttgggtgtggaacccagcaacttgaatatgatgatgt---tgaatccactactgccttcttccctaaactaccactct |
247186 |
T |
 |
| Q |
395 |
tcatcttttgatcaa---gcaaccacttcaacccaacttcgcttcctaagtatctgctgagcccggttggactctccgctccctt |
476 |
Q |
| |
|
| |||||||||||| ||| | |||| |||||||||| |||||||||||||||| || ||| || | | ||||||||||||| |
|
|
| T |
247187 |
ttgtcttttgatcaaccagcagctgcttcgacccaacttctcttcctaagtatctgcagatcccagtagtattctccgctccctt |
247271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 114; Significance: 1e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 21 - 134
Target Start/End: Complemental strand, 21241971 - 21241858
Alignment:
| Q |
21 |
cttagctttagccttcaggtttcatcttatcttggtagcaaagtacatttttattagatattagatggggttgatgttgggggtgaaagcactgcatata |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21241971 |
cttagctttagccttcaggtttcatcttatcttggtagcaaagtacatttttattagatattagatggggttgatgttgggggtgaaagcactgcatata |
21241872 |
T |
 |
| Q |
121 |
tgaaatagtaatag |
134 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
21241871 |
tgaaatagtaatag |
21241858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University