View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2736_low_19 (Length: 399)
Name: NF2736_low_19
Description: NF2736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2736_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 12 - 382
Target Start/End: Original strand, 47268879 - 47269252
Alignment:
| Q |
12 |
gaatatcgatacaaacaaatctaaaccatctcatttcagctgctagctgagaaaatgcaaatgcatttcctagaaaacatgtacatagacacc---atat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47268879 |
gaatatcgatacaaacaaatctaaaccatctcatttcagctgctagctgagaaaatgcaaatgcatttcctagaaaacatgtacatagacaccaccatat |
47268978 |
T |
 |
| Q |
109 |
atcatgtttgaagttgaccatgattagttattaagatatttgacggactaaattgagaaaaatactgctcaaacagatgcccttctcttgtctctgcaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47268979 |
atcatgtttgaagttgaccatgattagttattaagatatttgacggactaaattgagaaaaatactgctcaaacagatgcccttctcttgtctctgcaac |
47269078 |
T |
 |
| Q |
209 |
tgccagtggtcctctctctgcaaatagttcaaacatcagtgtacaaatttcattacaaaacaacgactccaaaactacacttgggaactattagttttat |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47269079 |
tgccagtggtcctctctctgcaaatagttcaaacatcagtgtacaaatttcattacaaaacaatgactccaaaactacacttgggaactattagttttat |
47269178 |
T |
 |
| Q |
309 |
gacaatcttatcatcaatatatcaaactgaaataccaaataaaaagtaaattttcagtaattatttattcaact |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47269179 |
gacaatcttatcatcaatatatcaaactgaaataccaaataaaaagtaaattttcagtaattatttattcaact |
47269252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University