View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2736_low_35 (Length: 291)
Name: NF2736_low_35
Description: NF2736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2736_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 15 - 160
Target Start/End: Original strand, 43638775 - 43638921
Alignment:
| Q |
15 |
cctgtgtggtggcgtgaaattcgtgggatgatgttcaacaccaaattagttcttttgcaaattggttcaccaaaattcatcgattatttggaggaaacgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43638775 |
cctgtgtggtggcgtgaaattcgtgggatgatgttcaacaccaaattagttcttttgcaaattggttcaccaaaattcatcgattatttggaggaaacgg |
43638874 |
T |
|
| Q |
115 |
taaaccatagagg-nnnnnnnntcatctctaatatatttgagcataa |
160 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43638875 |
taaaccatagaggaaaaaaaaatcatctctaatatatttgagcataa |
43638921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University