View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2736_low_38 (Length: 279)

Name: NF2736_low_38
Description: NF2736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2736_low_38
NF2736_low_38
[»] chr1 (1 HSPs)
chr1 (13-279)||(30496750-30497017)


Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 13 - 279
Target Start/End: Original strand, 30496750 - 30497017
Alignment:
13 aatattggtactgttgagttgagtagtcagagagaacacacagcgtgcagtggctagtctcatggattggagaaacctatttcttcttctattaatcaga 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30496750 aatattggtactgttgagttgagtagtcagagagaacacacagcgtgcagtggctagtctcatggattggagaaacctatttcttcttctattaatcaga 30496849  T
113 aattgcagtcactaggcttaaatcaagcagttatggggaaggtaaattttgttcagctttactgattc-ttttggcttcaattgcccgatctgttccctc 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
30496850 aattgcagtcactaggcttaaatcaagcagttatggggaaggtaaattttgttcagctttactgattctttttggcttcaattgcccgatctgttccctc 30496949  T
212 gtagtatgagatgagtagtatagtagtatagtacacaaacatgacttaattacatacaatttgggtga 279  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30496950 gtagtatgagatgagtagtatagtagtatagtacacaaacatgacttaattacatacaatttgggtga 30497017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University