View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2736_low_39 (Length: 273)

Name: NF2736_low_39
Description: NF2736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2736_low_39
NF2736_low_39
[»] chr3 (1 HSPs)
chr3 (15-255)||(48236495-48236735)
[»] chr1 (1 HSPs)
chr1 (140-196)||(3685864-3685920)


Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 15 - 255
Target Start/End: Complemental strand, 48236735 - 48236495
Alignment:
15 gagatgaaggctaggaaagaggcagaagagaggaataaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacactatgatggagattg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48236735 gagatgaaggctaggaaagaggcagaagagaggaataaagtattgaatgcattggctcaaaatgataatcgatatagaaaatacactatgatggagattg 48236636  T
115 aagttgctaccgagagattctcaccatcaaagaaactaggtgaaggtggatatggacctgtgtttaaaggtcaccttcatcacacaccagttgcagtcaa 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
48236635 aagttgctaccgagagattctcaccatcaaagaaactaggtgaaggtggatacggacctgtgtttaaaggtcaccttcatcacacaccagttgcagtcaa 48236536  T
215 actcttaaatcctgaagctgctcaaggcaggaagcaattca 255  Q
    |||||||||||||||||||||||||||||||||||||||||    
48236535 actcttaaatcctgaagctgctcaaggcaggaagcaattca 48236495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 3685864 - 3685920
Alignment:
140 atcaaagaaactaggtgaaggtggatatggacctgtgtttaaaggtcaccttcatca 196  Q
    ||||| |||| ||||||||||||||||||||||||||||||||||||| ||| ||||    
3685864 atcaatgaaaataggtgaaggtggatatggacctgtgtttaaaggtcaacttgatca 3685920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University