View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2736_low_53 (Length: 219)
Name: NF2736_low_53
Description: NF2736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2736_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 202
Target Start/End: Original strand, 41147828 - 41148009
Alignment:
| Q |
19 |
ctaaatgaagaagcttgcaatggttatggtcatttgatatgtcttaatgacattgaaggagaggaacagtgtttggaaatgatcgtcaagaagaagaatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
41147828 |
ctaaatgaagaagcttgcaatggttatggtcatttgatatgtcttaatgacattgaaggag--gaatagtgtttggaaatgatcgtgaagaagaagaatg |
41147925 |
T |
 |
| Q |
119 |
aatgtgttttcttttcaatcattttggtccccgcccagtcccacgttcaatttagtcattttcattaacaatttgaactatttt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41147926 |
aatgtgttttcttttcaatcattttggtccccgcccagtcccacgttcaatttagtcattttcattaataatttgaactatttt |
41148009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 77
Target Start/End: Complemental strand, 33184802 - 33184758
Alignment:
| Q |
33 |
ttgcaatggttatggtcatttgatatgtcttaatgacattgaagg |
77 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||| ||||||||| |
|
|
| T |
33184802 |
ttgcaatggttatggccatttggtatgtcttaatggcattgaagg |
33184758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University