View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2736_low_54 (Length: 209)

Name: NF2736_low_54
Description: NF2736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2736_low_54
NF2736_low_54
[»] chr7 (1 HSPs)
chr7 (20-185)||(46680323-46680488)


Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 20 - 185
Target Start/End: Complemental strand, 46680488 - 46680323
Alignment:
20 aaccctaaaccttcttctctttccgctcgtctcagcttcgtctttgatcaaattgacgctatcgaaaaagaacgttctcaaaaacacgaaactcttcaac 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46680488 aaccctaaaccttcttctctttccgctcgtctcagcttcgtctttgatcaaattgacgctatcgaaaaagaacgttctcaaaaacacgaaactcttcaac 46680389  T
120 gaattcgtgcttggcgtgattccaaaaacactcataaccaaattcccgaacaacccgtttcagaat 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46680388 gaattcgtgcttggcgtgattccaaaaacactcataaccaaattcccgaacaacccgtttcagaat 46680323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University