View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2736_low_54 (Length: 209)
Name: NF2736_low_54
Description: NF2736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2736_low_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 20 - 185
Target Start/End: Complemental strand, 46680488 - 46680323
Alignment:
| Q |
20 |
aaccctaaaccttcttctctttccgctcgtctcagcttcgtctttgatcaaattgacgctatcgaaaaagaacgttctcaaaaacacgaaactcttcaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46680488 |
aaccctaaaccttcttctctttccgctcgtctcagcttcgtctttgatcaaattgacgctatcgaaaaagaacgttctcaaaaacacgaaactcttcaac |
46680389 |
T |
 |
| Q |
120 |
gaattcgtgcttggcgtgattccaaaaacactcataaccaaattcccgaacaacccgtttcagaat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46680388 |
gaattcgtgcttggcgtgattccaaaaacactcataaccaaattcccgaacaacccgtttcagaat |
46680323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University