View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2737_high_8 (Length: 206)
Name: NF2737_high_8
Description: NF2737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2737_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 57 - 191
Target Start/End: Complemental strand, 13015790 - 13015656
Alignment:
| Q |
57 |
gacgccttgatcctagcattataacagtgggatttcagcttgtgttttttcctctcgtgcatcaacttgcatattatgcgtttgtgcttctacttgtgaa |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13015790 |
gacgccttgatcctagcattataacagtgggatttcaacttgtgttttttcctctcgtgcatcaacttgcatattatgcgtttgtgcttttacttgtgaa |
13015691 |
T |
 |
| Q |
157 |
tccgtttatggctttatgcattcatacaacctatg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13015690 |
tccgtttatggctttatgcattcatacaacctatg |
13015656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University