View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2737_low_7 (Length: 230)
Name: NF2737_low_7
Description: NF2737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2737_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 29036796 - 29036704
Alignment:
| Q |
1 |
ataaaaaatgtgagtatcttgaaattcttgaaatagttcgtcgcggcaaatagcgtcactcacaaaagaataaactttttattactttgagat |
93 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29036796 |
ataaaaaatgtgagcatcttgaaattcttgaaatagttcgtctcggcaaatagcgtcactcacaaaagaataaactttttattactttgagat |
29036704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 155 - 230
Target Start/End: Complemental strand, 29036627 - 29036552
Alignment:
| Q |
155 |
ccgacagaaaatggtgagaattatttttcatctgtgtaaatatttgaaaagaagtaaaattataatattgtacttt |
230 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29036627 |
ccgacagaaaatggggagaattatttttcatctgtgtaaatatttgaaaagaagtaaaattataatattgtacttt |
29036552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University