View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2738_low_8 (Length: 228)

Name: NF2738_low_8
Description: NF2738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2738_low_8
NF2738_low_8
[»] chr8 (1 HSPs)
chr8 (10-217)||(12940031-12940238)


Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 10 - 217
Target Start/End: Complemental strand, 12940238 - 12940031
Alignment:
10 catcatcaagggcatattcagattcacttgatcgacgatacttaagaatcataatgtgtcggcttgattacaaaaactctccacttatcaatatcaacat 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
12940238 catcatcaagggcatattcagattcacttgatcgacgatacttaagaatcataatgtgttggcttgattacaaaaactctccacttatcaatatcaacat 12940139  T
110 ttaaaactactcgaagccttgcaggacacttagtttgagtgatcagcctcgaattaatatcttgactctttcttcttatttttactcttaccctctctat 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||| |||||||||||    
12940138 ttaaaactactcgaagccttgcaggacacttagtttgagtgatcagcctcaaattaatatcttgattgtttcttcttatttttactctcaccctctctat 12940039  T
210 tacatatt 217  Q
    ||||||||    
12940038 tacatatt 12940031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University