View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2739_high_14 (Length: 444)
Name: NF2739_high_14
Description: NF2739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2739_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 2e-34; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 83 - 177
Target Start/End: Complemental strand, 33379439 - 33379345
Alignment:
| Q |
83 |
atattagaaatatgatcaacaaaagatgaattgacaatagctttagaatcttctc--tgtcaccctttgcggtagcatgataatataacatgcaaca |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33379439 |
atattagaaatatgatcaacaaaagatgaattgacaatagctttagaatcttctctttgtcaccctttgcggtagcatgata--ataacatgcaaca |
33379345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 12 - 84
Target Start/End: Complemental strand, 33379631 - 33379559
Alignment:
| Q |
12 |
atgaatcagatgattcgtcgcggtttttataaattttttgttgatctaggggaggaacgttttgaataacaat |
84 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33379631 |
atgaatcagatgattcgtcacggtttttataaattttttgttgatctaggggaggaacgttttgaataacaat |
33379559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 230 - 272
Target Start/End: Complemental strand, 33379279 - 33379237
Alignment:
| Q |
230 |
tgtcacacgtgcttaagaaaatttatttgtgtatttggatttc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33379279 |
tgtcacacgtgcttaagaaaatttatttgtgtatttggatttc |
33379237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 329 - 395
Target Start/End: Original strand, 42258033 - 42258103
Alignment:
| Q |
329 |
tgaagtatactgatatgctttgctaactgcatacaaatccag----agcataatgctaaataaaaattaat |
395 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
42258033 |
tgaagtatactgatatgctttgataactgcatacaaagccagaggcagcataatgctaaatcaaaattaat |
42258103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 329 - 395
Target Start/End: Original strand, 42263532 - 42263602
Alignment:
| Q |
329 |
tgaagtatactgatatgctttgctaactgcatacaaatccag----agcataatgctaaataaaaattaat |
395 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
42263532 |
tgaagtatactgatatgctttgataactgcatacaaagccagaggcagcataatgctaaatcaaaattaat |
42263602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University