View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2739_high_17 (Length: 395)
Name: NF2739_high_17
Description: NF2739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2739_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 1 - 387
Target Start/End: Complemental strand, 3573985 - 3573603
Alignment:
| Q |
1 |
actagtcttgaccataatgagaaagaatgctgataaatgcagtgaggtctgacactagtttcgaccataattgatgtcatctttgaactagaaagtgtct |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3573985 |
actagtcttgaccataatgagaa----tgctgataaatgcagtgaggtctgacactagtttcgaccataattgatgtcatctttgaactagaaagtgtct |
3573890 |
T |
 |
| Q |
101 |
atttgtgaaacatcatgctagcagccttttgcaatttacaaatgcacacaaaccatgtctctgatcataaattgattgccaattccatgacactgatagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |
|
|
| T |
3573889 |
atttgtgaaacatcatgctagcagccttttgcaatttacaaatgcacacaaaccatgtctctgatcataaattgattgccaaatccatgacactgataat |
3573790 |
T |
 |
| Q |
201 |
actttctgtgatagcaaaacttttgatcataaattcataattgatcaaatcattatagcagtacaacttaatcatccatagaacaaagttaaatgagcaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3573789 |
actttctgtgatagcaaaacttttgatcataaattcataattgatcaaatcattatagcagtacaacttaatcatccatagaacaaagttaaatgagcaa |
3573690 |
T |
 |
| Q |
301 |
gataagttaaattgacccttgaactacaattctgctgcatgaatcggagctggtcatacaatcaaccatgccgtccgttttcttctc |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3573689 |
gataagttaaattgacccttgaactacaattctgctgcatgaatcggagctggtcatacaatcaaccatgccgtccgttttcttctc |
3573603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University