View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2739_high_30 (Length: 244)

Name: NF2739_high_30
Description: NF2739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2739_high_30
NF2739_high_30
[»] chr8 (2 HSPs)
chr8 (4-140)||(13245524-13245660)
chr8 (207-244)||(13245727-13245764)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 4 - 140
Target Start/End: Original strand, 13245524 - 13245660
Alignment:
4 aagaatatagcggactttagaaagttatgtcgaaaacaaattcgagattttggtaataacacttcacacattttggaatcaattaccgattaattcttat 103  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||||||||||  ||||||||||||    
13245524 aagaaaatagcggactttagaaagttatgtcgaaaacaaattcgagattttagtaataatactttacacattttggaatcaattacgaattaattcttat 13245623  T
104 atggtcagaggagtttggatataccatttagacacac 140  Q
    ||||| ||||||||||||||| |||||||||||||||    
13245624 atggttagaggagtttggatacaccatttagacacac 13245660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 207 - 244
Target Start/End: Original strand, 13245727 - 13245764
Alignment:
207 gatgtatttttgtgtgttctaatgtgttattactcacc 244  Q
    ||||||||||||||||||||||||||||| ||||||||    
13245727 gatgtatttttgtgtgttctaatgtgttactactcacc 13245764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University