View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2739_high_30 (Length: 244)
Name: NF2739_high_30
Description: NF2739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2739_high_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 4 - 140
Target Start/End: Original strand, 13245524 - 13245660
Alignment:
| Q |
4 |
aagaatatagcggactttagaaagttatgtcgaaaacaaattcgagattttggtaataacacttcacacattttggaatcaattaccgattaattcttat |
103 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
13245524 |
aagaaaatagcggactttagaaagttatgtcgaaaacaaattcgagattttagtaataatactttacacattttggaatcaattacgaattaattcttat |
13245623 |
T |
 |
| Q |
104 |
atggtcagaggagtttggatataccatttagacacac |
140 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
13245624 |
atggttagaggagtttggatacaccatttagacacac |
13245660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 207 - 244
Target Start/End: Original strand, 13245727 - 13245764
Alignment:
| Q |
207 |
gatgtatttttgtgtgttctaatgtgttattactcacc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13245727 |
gatgtatttttgtgtgttctaatgtgttactactcacc |
13245764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University