View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2739_high_36 (Length: 217)
Name: NF2739_high_36
Description: NF2739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2739_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 16 - 201
Target Start/End: Original strand, 45177358 - 45177543
Alignment:
| Q |
16 |
ttattctgttggtacagttatttaattttactatcattattgagaaatgagaggttgaattcattattggctacaaggccatgcatttgttggtctaggc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45177358 |
ttattctgttggtacagttatttaattttactatcattattgagaaatgagaggttgaattcattattggctacaaggccatgcatttgttggtctaggc |
45177457 |
T |
 |
| Q |
116 |
ctagctagatttatgtatatgaatgttctgcagaatctactgagttttggcatcattatactgtatggttactactgtgtaaattt |
201 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45177458 |
ctagctagatttatgtatatgaatgatctgcagaatctactgagttttggcatcattatactgtatggttactactgtgtaaattt |
45177543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University