View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2739_high_39 (Length: 208)
Name: NF2739_high_39
Description: NF2739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2739_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 20 - 194
Target Start/End: Original strand, 44671292 - 44671466
Alignment:
| Q |
20 |
ggaaacattattatagtacacctgcaagacgtaattgaacaattaacaaaagcatgcatgaggttatatttaagtttgagattaatgctcttgtttctgn |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44671292 |
ggaaacattattatagtacgcctgcaagacgtaactgaacaattaacaaaagcatgcatgaggttatatttaagtttgagattaatgctcttgtttctgt |
44671391 |
T |
 |
| Q |
120 |
nnnnnnnnnnnnnnnngatattatgattcaaaacacttttttacacgataatgatcacaatcctaatgacctttg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44671392 |
ttttgttttttgttttgatattatgattcaaaacacttttttacacgataatgatcacaatcctaatgacctttg |
44671466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University