View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2739_low_26 (Length: 308)
Name: NF2739_low_26
Description: NF2739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2739_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 17368222 - 17368427
Alignment:
| Q |
16 |
cagcagcaaagtgtaaaaggaaacgattacacaagtgttttatttctatttggcatttatggggttccaaggaaaatggctttctgtgagtgttcttgtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17368222 |
cagcagcaaagtgtaaaaggaaacgagtacacaagtgatttatttctatttggcatttatgggtttccaaggaaaatggctttctgtgagtgttcttgtt |
17368321 |
T |
|
| Q |
116 |
ctcttcattgttcttgatcttagtatgctcactcttggtgatcacaagcttgaccaagaaaggtatggagatgattattgccgatatagacgtggacctc |
215 |
Q |
| |
|
||||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17368322 |
ctcttcattgttcttgatcttagcatgtttgctcttggtgatcacaagcttgaccaagaaaggtatggagatgattattgccgatatagacgtggacctc |
17368421 |
T |
|
| Q |
216 |
gctgta |
221 |
Q |
| |
|
|||||| |
|
|
| T |
17368422 |
gctgta |
17368427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 17363750 - 17363956
Alignment:
| Q |
16 |
cagcagcaaagtgtaaaaggaaacgattacacaagtgttttatttctatttggcatttatggggttccaaggaaaatggctttctgtgagtgttcttgtt |
115 |
Q |
| |
|
||||||||||||| || | ||||| | |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17363750 |
cagcagcaaagtgcaagaagaaacaagtacacaagtgttttctttctatttggcatttatgggtttccaaggaaaatggctttctgtgagtgttcttgtt |
17363849 |
T |
|
| Q |
116 |
ctcttcattgttcttgatcttagtatgctcactcttggtgatcacaagcttga-ccaagaaaggtatggagatgattattgccgatatagacgtggacct |
214 |
Q |
| |
|
||||||||||||||||||||||| ||| | |||||||||||||||||||||| ||||||||||| ||| |||||| |||| |||| ||||||||||||| |
|
|
| T |
17363850 |
ctcttcattgttcttgatcttagcatgtttgctcttggtgatcacaagcttgacccaagaaaggtttggggatgatgattgtcgatttagacgtggacct |
17363949 |
T |
|
| Q |
215 |
cgctgta |
221 |
Q |
| |
|
||||||| |
|
|
| T |
17363950 |
cgctgta |
17363956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University