View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2739_low_38 (Length: 218)
Name: NF2739_low_38
Description: NF2739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2739_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 200
Target Start/End: Complemental strand, 5461873 - 5461686
Alignment:
| Q |
14 |
attattctagaaacctttatattgtagaaaaa-tatggatgatacggtcgaaaatgcaatcgacttcaaaatcatttatattttagaactttgatgttaa |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5461873 |
attatgctagaaacctttatattgtagaaaaaatatggatggtacggtcgaaaatgcaatcgacttcaaaatcatttatattttagaactttgatgttaa |
5461774 |
T |
|
| Q |
113 |
tgcaggatctgaagaaatcacatgagtaccttgtgacatcatatggtgccgatccaacaggaaattcagatagcactgatgcacttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5461773 |
tgcaggatctgaagaaatcacatgagtaccttgtgacattatatggtgccgatccaacaggaaattcagatagcactgatgcacttct |
5461686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 139 - 191
Target Start/End: Original strand, 15159399 - 15159451
Alignment:
| Q |
139 |
taccttgtgacatcatatggtgccgatccaacaggaaattcagatagcactga |
191 |
Q |
| |
|
|||| ||||||||| |||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
15159399 |
taccatgtgacatcctatggtgcagacccaacaggcaattcagatagcactga |
15159451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University