View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2740_high_19 (Length: 241)
Name: NF2740_high_19
Description: NF2740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2740_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 1294141 - 1294257
Alignment:
| Q |
1 |
cgattgtttacatcttccttgtatgccaactgaaacgcagctatgtgtggataaaaaatgtatctgcatgggtttaacaattaagtcaaaaaataattat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1294141 |
cgattgtttacatcttccttgtatgccaactgaaacgcagctatgtgtggataaaaaatgtatctgcatgggtttaacagttaagtcaaaaaataattat |
1294240 |
T |
 |
| Q |
101 |
attacttaaaagcttat |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1294241 |
attacttaaaagcttat |
1294257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 120 - 223
Target Start/End: Original strand, 1294337 - 1294440
Alignment:
| Q |
120 |
taattatttgacaggccaagcagaacctctcaagataaatactttagttataaataattatttgtcttaattattttgcaatgcaaacaaaataatgtat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1294337 |
taattatttgacaggccaagcagaacctctcaagataaatactttagttataaataattatttgtcttaattattttgcaatgcaaacaaaataatgtat |
1294436 |
T |
 |
| Q |
220 |
attg |
223 |
Q |
| |
|
|||| |
|
|
| T |
1294437 |
attg |
1294440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University