View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2740_high_26 (Length: 223)

Name: NF2740_high_26
Description: NF2740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2740_high_26
NF2740_high_26
[»] chr4 (2 HSPs)
chr4 (15-205)||(2873609-2873799)
chr4 (144-204)||(2901395-2901455)


Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 15 - 205
Target Start/End: Original strand, 2873609 - 2873799
Alignment:
15 aatatgattatgattatgggtgaaaattgatgtccatacatgcaatggaacacccttttaatttggggattaatttaacataacttgcataatttannnn 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        
2873609 aatatgattatgattatgggtgaaaattgatgtccatacatgcaatggaacacccttttaatttggggattaatttaacataacttgcataatttatttt 2873708  T
115 nnnnnnnnnngtgatgcatagatttgctatctgagttatgtagaagagaaaaagaagcaaagatcataccagacccagatattgatgtcta 205  Q
              |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2873709 ttatttttttgtgatgcatagatttgctatctgagttatgtagaagagaaaaagaagcaaagatcataccagacccagatattgatgtcta 2873799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 144 - 204
Target Start/End: Complemental strand, 2901455 - 2901395
Alignment:
144 tctgagttatgtagaagagaaaaagaagcaaagatcataccagacccagatattgatgtct 204  Q
    |||||||| | |||||||||||| ||||||||||| |  ||||||||||||||||||||||    
2901455 tctgagttgtctagaagagaaaaggaagcaaagattaagccagacccagatattgatgtct 2901395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University