View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2740_high_4 (Length: 372)
Name: NF2740_high_4
Description: NF2740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2740_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 82 - 357
Target Start/End: Complemental strand, 43608439 - 43608164
Alignment:
| Q |
82 |
gcatttccatgtcacatacttttgggttcttgcaaaatatttatgctcatccaacatttgtaaagaatgtcttgacagtatcaaacagattcaaatattc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43608439 |
gcatttccatgtcacatacttttgggttcttgcaaaatatttatgcttatccaacatttgtaaagaatgtcttgacagtatcaaacagattcaaatattc |
43608340 |
T |
 |
| Q |
182 |
aaactaaatactcttgaaatcactattcagaagtatcagagtgttgtgtgagtgttaagtgtatatatgatccatcttggagacagacatggctcctttt |
281 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43608339 |
aaactaaatagtcttgaaatcactattcagaagtatcagagtgttgtgtgagtgttaagtgtaaatatgatccatcttggagacagacatggctcctttt |
43608240 |
T |
 |
| Q |
282 |
gttgaaggtttagtgcttcatagcttgcagatacactcaaaacaatattataatataattagctttaagctctgtt |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43608239 |
gttgaaggtttagtgcttcatagcttgcagatacactcaaaacaatattataatataattagctttaagctctgtt |
43608164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University