View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2740_high_8 (Length: 257)
Name: NF2740_high_8
Description: NF2740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2740_high_8 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 33645926 - 33645687
Alignment:
| Q |
18 |
ggtatattgattatttcaacataaccttctctattttgcagagaatatagaaacatagtcaatgttcatttcttggttgtaatattgtttggtataatct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33645926 |
ggtatattgattatttcaacataaccttctctattttgcagagaatatagaaacatagtcaatgttcctttcttggttgtaatattgtttggtataatct |
33645827 |
T |
 |
| Q |
118 |
tgttttaaaatttgaatagtaacttgttgaagaaagaatccttccaaagtcaacatgttttggtgcctatttggattatttatagatcaatattaggtaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33645826 |
tgttttaaaatttgaatagtaacttgttgaagaaacaatccttccaaagtcaacatgttttggtgcctatttggattatttatagatcaatattaggtaa |
33645727 |
T |
 |
| Q |
218 |
agcacatggctggtctaatggattttttattataagtggt |
257 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33645726 |
agcacatggctggtctaatgaattttttattataagtggt |
33645687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University