View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2740_low_19 (Length: 243)

Name: NF2740_low_19
Description: NF2740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2740_low_19
NF2740_low_19
[»] chr1 (1 HSPs)
chr1 (174-228)||(29741398-29741452)


Alignment Details
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 174 - 228
Target Start/End: Original strand, 29741398 - 29741452
Alignment:
174 gtgctctcccctttcttgaacttatactctcttccgacttttttggtctctaatt 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29741398 gtgctctcccctttcttgaacttatactctcttccgacttttttggtctctaatt 29741452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University