View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2740_low_23 (Length: 238)
Name: NF2740_low_23
Description: NF2740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2740_low_23 |
 | |
|
| [»] scaffold0236 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0236 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 21152 - 21384
Alignment:
| Q |
1 |
ccccggtatcagtaacgacagtgatattgctatcggacttggtgctgaaagagatcgaggatcggtgcaaattggggtgattttgttggggtatatggtg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21152 |
ccccggtatcagtaacgaccgtgatattgctatcggacttggtgctgagagagatcgaggatcggtgcaaattggggtgattttgttggggtatatggtg |
21251 |
T |
|
| Q |
101 |
acggatagtgcttcagtatcaatgacgttcaagtttggcccaaatgctgtaaaatttccagctggtagcagaaatggtgcctggtcttgggcgattcctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21252 |
acggatagtgcttcagtatcaatgacgttcaagtttggcccaaatgctgtaaaatttccagctggtagcagaaatggtgcctggtcttgggcgattcctc |
21351 |
T |
|
| Q |
201 |
gcccaatattgatgcataatttcatggtgtagt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21352 |
gcccaatattgatgcataatttcatggtgtagt |
21384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University