View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2740_low_23 (Length: 238)

Name: NF2740_low_23
Description: NF2740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2740_low_23
NF2740_low_23
[»] scaffold0236 (1 HSPs)
scaffold0236 (1-233)||(21152-21384)


Alignment Details
Target: scaffold0236 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: scaffold0236
Description:

Target: scaffold0236; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 21152 - 21384
Alignment:
1 ccccggtatcagtaacgacagtgatattgctatcggacttggtgctgaaagagatcgaggatcggtgcaaattggggtgattttgttggggtatatggtg 100  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
21152 ccccggtatcagtaacgaccgtgatattgctatcggacttggtgctgagagagatcgaggatcggtgcaaattggggtgattttgttggggtatatggtg 21251  T
101 acggatagtgcttcagtatcaatgacgttcaagtttggcccaaatgctgtaaaatttccagctggtagcagaaatggtgcctggtcttgggcgattcctc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21252 acggatagtgcttcagtatcaatgacgttcaagtttggcccaaatgctgtaaaatttccagctggtagcagaaatggtgcctggtcttgggcgattcctc 21351  T
201 gcccaatattgatgcataatttcatggtgtagt 233  Q
    |||||||||||||||||||||||||||||||||    
21352 gcccaatattgatgcataatttcatggtgtagt 21384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University